See something you'd like to change or add, but you've never edited an open encyclopædia before? This overview was written to help absolute beginners get started.

Talk:Great flood

From A Storehouse of Knowledge

(Redirected from Talk:Great Flood)
Jump to: navigation, search

Contents

Balance

Is there any chance of balancing this article out or are dissenting views going to be censored? Neveruse513 13:08, 26 March 2009 (UTC)

Go ahead and try--I'm keen to see what happens. TheoryOfPractice 13:12, 26 March 2009 (UTC)
If you mean "Is this article going to suggest that the flood may not have happened?", then I'm afraid the answer is no, as that would conflict with the stated aims of this site.--CPalmer 13:12, 26 March 2009 (UTC)
Unless you could find a biblical basis for interpreting the flood story as a metaphor or vision? I don't know of a specific argument along those lines, but it would be an interesting avenue to explore.--CPalmer 13:20, 26 March 2009 (UTC)
I don't know why it has to be Biblical (unless that is stated somewhere and I haven't read it yet)...apologetics don't necessarily have to be Biblical, do they? Neveruse513 13:22, 26 March 2009 (UTC)

Testing the Waters

Should the argumentum ad populum in the third paragraph be allowed to stand as is? Should it be removed? Should it be made clear that the statement is irrelevant to the veracity of the story?

Argumenta ad populum for other claims running contrary to the Christian worldview have been left out, which I do not have any problem with so long as we're consistent. A good wiki is based on consistency. Is this wiki going to be consistently logical or consistently fallacious? Neveruse513 13:18, 26 March 2009 (UTC)

Removed. TheoryOfPractice 13:22, 26 March 2009 (UTC)

The Book by Scientists from Columbia

This sentence seems to be just hanging out there. I don't think it adds anything on it's own. In fact, I think it conceals more than it reveals. There are tons of books about the feasibility of the flood. I get the impression from this article that there is one. Perhaps a section "Books on the Feasibility of the Flood"? Maybe a table that could allow for a view (feasible/infeasible), author, publisher, date, etc. Or maybe a balanced selection for each? Neveruse513 13:35, 26 March 2009 (UTC)

Scientists

I have changed the line to name the scientists in question. I have also changed 'Published' to 'written' as I would very much doubt they actually published the book! RedDog 14:24, 26 March 2009 (UTC)

The book was published. Check ref 1. Neveruse513 14:26, 26 March 2009 (UTC)
The ref says 'Publisher: Simon & Schuster (January 25, 2000)' so I don't think I'm wrong here. I am not disputing that the book was published at all - clearly it was, it exists! Rather I was disputing that the two scientists published the book themselves which is what the article said at the time of my edit. Publishing and writing are two different things. Unless I've misunderstood I am correct and the ref backs me up. RedDog 14:37, 26 March 2009 (UTC)
I think you're confused about the names. Also, see http://www.simonandschuster.com/
Oh, I see! lol...yeah, they didn't publish it themselves. Neveruse513 14:41, 26 March 2009 (UTC)
I see the confusion - a better to have phrased it would have been: I would very much doubt they actually published the book by themselves Sorry for the confusion and thanks for the links. RedDog 14:42, 26 March 2009 (UTC)

Ryan and Pitman

Should reference to this book be removed? They place the flood around 7500 years ago, which is too far back for any coherent Biblical literalist. Biblical literalism yields a date of creation no more than 7200 years before present. Neveruse513 15:39, 26 March 2009 (UTC)

Heh. Once again reality reveals that it is biased against YEC. How much is enough? TheoryOfPractice 15:41, 26 March 2009 (UTC)
I like the article now - very concise. I'm not sure the second paragraph is really necessary though.--CPalmer 15:53, 26 March 2009 (UTC)
References to flood mythology from around the world are commonly cited as enforcing the worldwide, Biblically literal nature of the flood. I think it needs a good reference. Neveruse513 15:57, 26 March 2009 (UTC)
After careful consideration, this should remain as it is encylopedic and does not appear to fail Regulation 5. Geo.plrd 16:44, 26 March 2009 (UTC)
I think it pretty clearly fails regulation five as it is "not inconsistent with the standards and views of this site", namely the view that "God directly created the universe and everything in it approximately six thousand years ago." Regulation five does provide for the inclusion of this link so long as a warning of content is provided. I will remove the content until such a warning is added, as I am not familiar with the template to do so. Neveruse513 16:57, 26 March 2009 (UTC)
While there are different schools of thought on YEC dating, there is a fairly large segment that sees latitude in a literal 6000 year old earth. To remove any information as going against YEC because it speculates the flood took place 7500 years ago would be to deny these people and their YEC perspective. Augustine 08:00, 27 March 2009 (UTC)
I do not believe that the Bible was written according to the Gregorian calendar. As such, exact timing could be more than or less than 6,000 years (a day with God is as 1,000 years)Geo.plrd 15:47, 30 March 2009 (UTC)
Unfortunately, that's not the exegesis endorsed by this wiki. Neveruse513 15:49, 30 March 2009 (UTC)
No, not the Gregorian calendar, but days were still days, and the second half of the verse you quoted says that 1000 years is as a day. The verse is not trying to define day the length of a day. Philip J. Raymentdiscuss 05:38, 31 March 2009 (UTC)

Feasibility of the Flood list

I like that idea. If anyone has any other sources (I guess preferably, good YEC sources) then please list them. AddisonDM 16:34, 26 March 2009 (UTC)

Would Woodmorappe's Ark Feasibility Study go here or in an article about the Ark? Or here until there is an article about the Ark? Neveruse513 17:04, 26 March 2009 (UTC)
If it's good info, let's put it here for now. When there's an Ark article, we can move it. AddisonDM 17:10, 26 March 2009 (UTC)

Recent additions

Recent additions have been made that may violate the rules and regulations of the site. I think this is going to be a good exercise of those rules and regulations on behalf of the administrators so that we can all see exactly how they are meant to work. Neveruse513 21:30, 26 March 2009 (UTC)

Actually, I had talk switched off in my recent changes view, so missed the above. Yes, there was a fair bit that violated the rules and regs, and I removed it. Although see below shortly.BradleyF (LowKey) 08:59, 27 March 2009 (UTC)

Seeking to Clarifcation to Some Points Above

There are many problems with the Great Flood which I would really like to explore. Can this be done in this article without violating the rules. Problems such as where did the water come from, where did it go, how was the orbit of the earth effected by it's change in weight, salt water fish vs fresh water fish, other peoples who apparently survived, why death on such an enormous scale was required, what happened to the millions of corpses (human and animal), how plants survived being under water for so long, etc, etc. I do not believe any wiki should duck such obvious practical difficulties but should provide clear logical answers. Is this page the right place? RedDog 08:43, 27 March 2009 (UTC)

Yes this (talk) page is the right place, at least until debates are going, or someone writes an essay and invites discussion.BradleyF (LowKey) 09:15, 27 March 2009 (UTC)
I am not as versed as many in Creationist knowledge, but I am aware there are answers to many of your inquiries.
1) It mostly spouted up from the earth
2) The oceans
3) How would the weight have changed?
4) Not sure
5) Unaware of what you mean by other people apparently survived
6) The wickedness of man
7) What happens to corpses every day?
8) Plant seeds are pretty hardy. And regrowth rates after devastation have often surprised scientists.
Augustine 08:57, 27 March 2009 (UTC)
Thanks for the replies Augustine and that's exactly the kind of thing I had in mind. But I wasn't lookig for answers specifically, more permission to add and explore these points in the article (or in another article or something). I am not going to nit pick through your answers (they sound good) but I would appreciate refs. For example where in the Bible does it say it mostly spouted from the earth? Please don't answer that question here. I'm sure you know the answer. It's just an example of the kind of thing I feel we should be exploring. I don't want to just wade into the article itself as I might look like I'm just trying to tear it apart. I'm not. I want clear logical answers to obvious questions / problems. RedDog 09:12, 27 March 2009 (UTC)
I think what you will find is that YEC has answers for many more subjects than they are usually given credit for, but there are still some areas where answers are unknown. I am aware they do have an answer for #4, as Bradley eludes below, but I don't know what it is. The Bible verse for the waters from the deep is Genesis 7:11 "-- On that day all of the springs of the great deep burst forth, and the floodgates of the heavens were opened." Most people when questioning YEC thought don't realize that the Bible says it is more than rain from the sky. Augustine 17:24, 27 March 2009 (UTC)

(EC) Here are my (admittedly very brief and off the cuff) responses

  1. The Bible refers to the "fountains of the deep" implying vast subterranean (sp?) sources.
  2. Yep the oceans.
  3. The weight didn't change
  4. see Woodmorappe's book
  5. see Biblical worldview for comments about the chronologies in question
  6. "Only evil all the time"
  7. Rotting, and fossils
  8. Much didn't, some did. Floating vegetation mats etc

More anon. I think a "feasibility" article in its own right has merit, with this discussion taken to that talk. The article itself would still need to comply with a Biblical worldview, but what goes in can be discussed first.BradleyF (LowKey) 09:15, 27 March 2009 (UTC)

I would LOVE to explore these points further and really appreciate both the posts above. I will restrain myself until a feasability article is created though. Thanks both. RedDog 09:51, 27 March 2009 (UTC)
Can we PLEASE avoid rapid subduction and canopy theory? I don't think it's been brought up yet...I just really don't want it too...
Which of Woodmorappe's book are you talking about? Noah's Ark: A Feasibility Study is pretty much about the Ark, not the weather. If it's a different one, please add it to the further reading section. Neveruse513 12:56, 27 March 2009 (UTC)
Yep, that one. It doesn't cover all the points above, but what it does cover it covers quite well. I would suggest RedDog go to creation.com or christiananswers.net and type in each of those questions in the search boxes. There really has been a lot of work done on these questions.BradleyF (LowKey) 14:00, 27 March 2009 (UTC)
I don't have it in front of me at the moment (it's at home), but I'm pretty sure it covers none of the points above. It's about the number of animals, feeding, alternative food sources, HVAC, water collection, refuse removal, breeding, etc. It's not about the feasibility of the flood at all. Perhaps you're thinking of Studies in Flood Geology? Neveruse513 14:17, 27 March 2009 (UTC)

(outdent) I just looked over the list of questions, and NA:AFS only addresses one, the fresh/salt water issue for fish. What can I say? It was late & I was tired. Nevertheless the websites, particularly creation.com should provide answers, and further sources. Anyone have the time to make a start on a "feasibility" article (even if it gets moved off the main namespace at some stage)? I don't, at the moment.BradleyF (LowKey) 14:35, 27 March 2009 (UTC)

total mass of earth didnt change but the distance of mass from the axis would have changed if subterranean waters were now on the surface. That has simplke physics involved in spin rate Hamster 05:28, 29 March 2009 (UTC)

A belated comment

I didn't have this article on my watchlist, and have only now had a look at it since the earliest edits.

I see that most of the issues have been addressed if not sorted out, but I just wanted to say that Gulik's additions (since removed) is an example of the utter nonsense that some anti-creationists carry on with. Addressing each of his six "evidences" in turn, I would suggest that only two (actually two different forms of the same one, the saltiness) even have prima facie merit.

  • "All the water needed to cover the surface of the planet to a depth of 3000+ feet has vanished.": The "flood theory" doesn't propose that, so why list evidence that doesn't address the claims of the theory?
  • "Despite the fact that the entire human race supposedly descended from Noah's family, most of us don't look Jewish.": Noah was not a Jew.
  • "Salt water does bad things to soil fertility, yet vegetation (which was apparently taken onto the Ark) was flourishing as soon as the waters receded.": This question presumes that the saltiness of the flood waters was similar to the saltiness of the oceans today, an unwarranted presumption.
  • "Most freshwater fish can't survive in salt water, and vice versa. Yet fish survived the Flood quite well. Trilobites, however, did not.": Per previous answer to some extent, but there's more to it, including that the assertion of non-survival is not totally true.
  • "Aquatic dinosaurs, such as Plesiosaus and Moasaurs, did not survive the Flood, despite being naturally air-breathing swimmers. Whales did.": Who says they didn't? That's not "evidence", that's assertion.
  • "Both the Chinese and Egyptian civilizations went merrily flourishing at a time when Young Earth Creationists assert they were at the bottom of the ocean.": Restated, "your theory (the flood) doesn't fit with my theory (the age of those civilisations) so your theory is wrong". Illogical.

Philip J. Raymentdiscuss 14:13, 28 March 2009 (UTC)

Sorry to not indent, I'm lazy.

  • What does the flood theory propose, if not to drown all land on the planet?
  • Silly issue refuted. So what "race" was Noah, by the way?
  • Your argument begs the question. Are you saying that all waters on earth were similar in levels of salt concentration 4-5000 years ago? And what do you assert that level to be?
  • Per previous answer, there sure is more to it. Are you claiming that salt vs. fresh water fish all "evolved" (or something like that?) since the flood? Evidence?
  • Who says they didn't? Evidence, I guess. Although maybe Nessie is one? Of course, saying "we haven't seen one" could nicely be argued against by such things as coelacanth?
  • The age of those civilisations is well documented. Your claim is equally, if not more, illogical. The argument against which you argue is only "illogical" if one takes your suppositions (YECC) to be fact first. If one examines the evidence, your claims are the ones that fall into the range of illogic.

Again, sorry for not indenting. ħuman Number 19 05:17, 29 March 2009 (UTC)

  • So you're questioning an idea that you don't know what it says? Yeah, that makes sense!
  • Noah (with his family) was the ancestor of all of mankind (except the ones before him, of course).
  • I don't follow your question. But see below.
  • Something like that, in a very general sense. But see further below.
  • What evidence? Or are you talking about a lack of evidence? An argument from silence?
  • So not only is my theory wrong because my theory doesn't fit with your theory, but you now assert that your theory is right! Argument by assertion doesn't cut it. The ages are only "well documented" on the basis of your theory.
For the "see below"s, see here, chapters 10, 12, and 14 cover most of it, I think. Chapter 18 would cover the one about Noah.
Philip J. Raymentdiscuss 15:25, 29 March 2009 (UTC)
I have to admit I love this challenge. Removing all of the speculations and concentrate by looking at the physical argument of could the earth have been covered with water let's consider the following.
  1. Radius of the earth at the equator is 6357 to 6378 km [1]
  2. Known water on earth is 1,360,000,000 km3 [2]
Surface area of the earth is 507,825,244.6 to 511,185,931.9 km2 (Area=4pi*r*r)
That would give us a .0491 km to .0490 km depth or 160 feet of water covering the earth.
Keep in mind that this based on the calculations from the radius at the equator and the radius at the poles (earth is not a true sphere).
I know this is rough but the question this raises is what happened to the rest of the water if indeed the world was truly flooded so no land was exposed? (this calculation is independent of the shape of the land and assumes the sphere of the earth is flat). We know that the bible had mentioned mountains, Mt Ararat for example, that have peaks much higher than 200 feet. Not to mention for there to be enough water to have a depth of 1000 ft we would need an additional 322,693,202,333 km3 of water ( 324,053,202,333.09-1,360,000,000) almost 238 times more water than what is currently known to be on the earth. So what happened to the water?--Timsh 16:24, 29 March 2009 (UTC)
To get the depth of 1,360,000,000 km3 spread over 507,825,245 km2, isn't the formula divide the first by the second? If so, the answer is 2.68km, not .0491km.
And Ararat was mentioned at the end of the flood, not prior to it.
Philip J. Raymentdiscuss 00:31, 30 March 2009 (UTC)
I am afraid not. The issue is that you are dealing with values with different bases and exponents. The rule that you are using to divide is only correct if the bases are the same, then all you do is subtract exponents. 22/21=22-1=1 or 4/2=2. What you are trying to do is this, 33/42 = .751 which is not true, 33 = 27 & 42=16, 27/16 = 1.6875. You have to take the cuberoot of the first value and squareroot of the second then divide to get the km, to bring the exponent values to be the same. None the less, I hope the authors did not make that mistake and round up when they posted their paper. 2.68km rounding to 3km, .4 km is a huge difference when dealing with volume spread around a sphere of such a large diameter.--Timsh 04:19, 30 March 2009 (UTC)
Sorry, but I'm still not convinced. No, I was not trying to divide 33/42 to get .75. I was trying to divide 33/42 to get 1.6875.
Eight cubic metres of water is, conceptually, two metres wide by two metres deep by two metres high. That is, it sits on an area of two square metres and is two metres high. To get the height, you divide the volume (8) by the area (4), to get the height (2). Your formula would have me dividing the cube root of the volume (2) by the square root of the area (2) to get the height. But the height is 2, not 1.
Philip J. Raymentdiscuss 09:12, 30 March 2009 (UTC)
Perhaps this will help. The volume of a cube is calculated by length*width*height, therefore x3=l*w*h. The square footage is l*w leaving h to be the unknown so we have sqft2=l*w causing x3=sqft2*h. In order to get the h we need to divide x by sqft however we need to cube root and squareroot the numbers to bring them to the same exponent. I see there is an issue of understanding about volume it is in 3 dimentions. The volume of water is a cube while the surface area of the earth is squared.--Timsh 12:21, 30 March 2009 (UTC)
Try this. You have 10 square feet of ground, and 100 cubic feet of dirt you are putting there. How deep will the dirt be? The answer is 100/10=10. If you start taking cube and square roots, you are going to throw off your answer. --TimStalk 12:34, 30 March 2009 (UTC)
The reason why your math is working out in these examples is that you are using a multiple of the same base. Try something a little different such as 27 cubic feet of dirt on a 4 sqft plot. What do you get?--Timsh 12:42, 30 March 2009 (UTC)
Hang on a tick. You're saying that our maths is "working out"? So my example of eight cubic metres "works out" (i.e. correctly) to 2 metres high. If both my formula and your formula gave the same results, then it may be true that my formula is not correct for all cases. But your formula did not give the correct results, whilst mine did! Please explain that.
By the way, for your 27 cubic feet of dirt on a 4 square foot plot, I get 6.75 feet high. How is that wrong?
Philip J. Raymentdiscuss 13:59, 30 March 2009 (UTC)

Philip, I want to sincerely apologize for my stupidity. I should have double checked the algebra and realized early on that km is the base not the actual value. You are correct in your value of ~2.68 or roughly 8,792 ft. Goes to show what little sleep and a 2 year old can lead to in terms of simple mistakes.--Timsh 19:52, 30 March 2009 (UTC)

goddidit. TheoryOfPractice 16:27, 29 March 2009 (UTC)
Thanks for a very helpful comment. Not. Philip J. Raymentdiscuss 00:31, 30 March 2009 (UTC)
Well, I am sure that could be the argument, however I know that Philip has tried to explain concepts like this with physcial models in the past. Just to point out, yes Philip I used your link above which led me to chapter 12 page 178, their model assumes a depth of 3km given the volume of water currently on the planet. Since they offered no sources for their calculations I have to ask where they retrieved these numbers? Either they are assuming there is 308,983,432,691,470 km3 of water on the earth which is far greater than what the USGS is reporting (makes me question my tax money) or they are assuming the diameter of the earth is much smaller at 658 km and surface area being 1363902.3 km2 (which is once again much smaller than what is currently known).--Timsh 16:49, 29 March 2009 (UTC)
It is my understanding that the average ocean depth is over a mile deep. It is also my understanding that 3/4's of the earth's surface is covered by oceans (approx). I don't know anything about the specific numbers you are using, but it would appear there is plenty of water to have covered a 1000 foot peak if the earth's surface was more smooth and we didn't have the deep valleys that hold water that we do today. Augustine 17:04, 29 March 2009 (UTC)
I can respect that observation, hence the need for the computations. At first look all land looks pretty flat when you are in the Midwest of the US, however the average elevation is near 1k feet, higher as you hit the foot hills. On the east coast of the US the average elevation is near 2k feet. Even though there are valleys in the ocean they only account for a little of the displaced volume of water. The measurement from USGS is the volume of water found in marine, icepack and freshwater systems. This measurement is done by satellite using elevation and displacement calculations. As such, even though there is enough water on the surface there still is not enough to cover the whole earth more than 160 ft. It is all about perception, there are places in the Great Lakes where you are unable to see the shore, looks like a lot of water but in perspective to the vast amount on Earth it is a tiny percent. Interesting enough, tangent, there is research from a professor an some Midwest school (can not remember all of the details now) that is saying that the great flood in the bible could have happened based on the perspective of the peoples that lived in the Persian Gulf during an end of an ice age where the water ended up breaking through a natural damn formed by the mountains at the mouth of the current gulf. I will try to find a link.--Timsh 20:34, 29 March 2009 (UTC)
You are looking for William Ryan and Walter Pitman from Columbia University. It is currently being explored by Robert Ballard - an oceanographer who works in the area of underwater archeology (Titanic, Bismark, Yorktown, PT-109). --Shagie 22:16, 29 March 2009 (UTC)
In my opinion, the biggest flaw with the flood theory is that all human diversity evolved from Noah and his family. If you tried to populate the earth with 8 people, all you'd end up with is a buch of hemophiliacs with teeth growing out of their eyes. Genetic diversity kinda shoots down flood theory. Theemperor 22:29, 29 March 2009 (UTC)
Genetic problems caused by inbreeding are due to offspring inheriting the same genetic problems from both parents (if the parents are not closely related, the chances of getting the same defects from both parents is much less). But it's not going to be a problem if the parents have no or very few defects, which is the case close to creation when they were created without defects. See chapter 8 of that same reference. Philip J. Raymentdiscuss 00:35, 30 March 2009 (UTC)
Yes, they are. But it had been quite a while since creation, and if the genetic defects didn't exist then, they wouldn't exist now, unless evolution was indeed possible, which you deny. --Acionyx 00:42, 30 March 2009 (UTC)
Rather than vague claims, be specific. Just how many generations since creation was it? And creationists do not deny the existing of defect-generating mutations, but of information-adding mechanisms that microbe-to-man evolution requires. Philip J. Raymentdiscuss 00:56, 30 March 2009 (UTC)

Here you go

Feasibility of the Great Flood. It's a rough start. Let's begin. AddisonDM 03:35, 29 March 2009 (UTC)

"all living things except Noah, his family, and the animals aboard the ark"

What about fish? Or plant life? I'm certainly no expert, but I can't see how a flood could kill salt-water fish. Pink(Inertia presides over burnt modernist strides) 03:55, 29 March 2009 (UTC)

Marine animals live in balance with the osmotic pressure of the water they live in. A freshwater fish has its cells at a lower density than sea water (but more dense than fresh water) so it needs to swallow water to bring minerals that are being lost through osmosis. A salt water animal has the opposite issue - it needs to drink sea water and filter out the minerals to dilute the build up of minerals. Give Difference Between Saltwater And Freshwater Fish (the website is blocked by the spam filter) a read.
For fish, salmon have specialized mechanisms to handle the exchange of salt and gasses in varying degrees of salinity, though it does take its toll (and eventually kills them). When Salmon are born they are freshwater fish with hyperosmotic body fluids. When they migrate to the ocean, the body changes into a hypoosmotic fluid. This change happens only once. Some further reading at http://www.thenakedscientists.com/HTML/content/questions/question/1997/ http://en.wikipedia.org/wiki/Salmon#Life_cycle http://en.wikipedia.org/wiki/Stenohaline
Whales in fresh water are another situation. There are several issues that whales have. First off, saltwater is more dense than river water and so it takes more effort for the whale to swim and surface - they become exhausted much more easily. Another issue is that cuts and scrapes don't heal as fast in fresh water on a whale. Whales also will not have access to their food source in fresh water. Further reading: http://articles.latimes.com/2007/may/23/local/me-whales23
--Shagie 06:36, 29 March 2009 (UTC)
See chapter 14 in the link I just posted above. Philip J. Raymentdiscuss 15:26, 29 March 2009 (UTC)
"So, many fish species today have the capacity to adapt to both fresh and salt water within their own lifetimes. " Only a small percentage of the fish species can tolerate changes in salinity for long (greater than a few minutes). There are species that live near the fresh and saltwater interface that will swim from one to the other briefly to kill parasites or elude predators but this is not a long term adaptation. If what is suggested in the link above was the case, you should be able to keep a gold fish and a clown fish in the same tank. I will also point out that the ichthyosaurs (mentioned in the link) was not a fish but a reptile (think of it more as a very well adapted crocodile) and was air breathing (no gills) - they would have the same survivability as a whale or dolphin. One other bit that was mentioned in the link - a halocline (last paragraph of the fish section) only forms when freshwater is deposited on top of saltwater (caves, fjords, extreme latitudes). This contradicts the previous paragraph - you can't have both. --Shagie 17:05, 29 March 2009 (UTC)
Regarding the first part of your post, you've picked out one point in isolation and ignored the rest of the explanation. The argument is that multiple factors are involved, and yes, any one factor is not going to be an adequate explanation, but all together gives a reasonable explanation.
Regarding your last point, you can't have both at the same time and place, but you can have them at different times (not really applicable here) and different places. The halocline is specifically mentioned as possibly being "in some parts", and that turbulence "may have been sufficiently low at high latitudes".
Philip J. Raymentdiscuss 00:51, 30 March 2009 (UTC)

Large chunk cut, belongs elsewhere

Evidence Supporting the Flood Theory

I have excised a large portion of the article. The content belongs elsewhere. There is a feasibility article started where this could go, but much of it is probably redundant. Most of this was removed once before, with explanation and the suggestion to create the feasibility article. This needs to be interleaved over at that article. I currently don't have the time, but I have pasted below everything that I cut from the article. BradleyF (LowKey) 23:41, 29 March 2009 (UTC)

Content that was cut starts here

  • God is omnipotent.
  • Many cultures tell of it. For example, an ancient legend about Zeus has a global flood.

Evidence Complicating the Flood Theory

  • All the water needed to cover the surface of the planet to a depth of 3000+ feet has vanished. This amount of water would be necessary to ensure that animals couldn't survive on mountains.
  • Despite the assertion that the entire human race supposedly descended from Noah's family, there is no way we could have produced this many human beings in so short a time. In addition, most of us don't look the same. In addition, one family would require incest and genetic inbreeding. An example of a severe case on inbreeding is the cheetah, which has cramped teeth as a result. Humans do not have these kinds of defects.
  • Salt water does bad things to soil fertility, yet vegetation (which was apparently taken onto the Ark) was flourishing as soon as the waters receded. Even if the water was not salt water, the soil would still be too flooded for anything but swamp plants to survive.
  • Most freshwater fish can't survive in salt water, and vice versa. Yet fish survived the Flood quite well. Trilobites, however, did not.
  • Aquatic dinosaurs, such as Plesiosaus and Moasaurs, did not survive the Flood, despite being naturally air-breathing swimmers. Whales did. We know this because we see whales, and despite actively looking for them, we haven't seen Plesiousaurs.
  • Both the Chinese and Egyptian civilizations went merrily flourishing at a time when Young Earth Creationists assert they were at the bottom of the ocean. We know this because of carbon dating and their own records.
  • Natural formations like the Grand Canyon are attributed to the Biblical Flood as opposed to river-caused erosion over millions of years, yet there is no consistent explanation for how erosion on this scale could occur only in isolated locations like Arizona or Kauai, and not all over the globe.

I have a question...

How was it the Noah managed to get all the bacterias and virus together on the ark without getting infected by them. Some of those are pretty nasty, like Anthrax, and you wouldnt want it just floating around in an Ark. Ace McWicked 01:16, 30 March 2009 (UTC)

Didn't CP recently "prove" they didn't know about bacteria then? Uh-oh... Pink(Inertia presides over burnt modernist strides) 01:17, 30 March 2009 (UTC)
Either way they still exsisted, if I were Noah, I wouldn't want to fool around with Ebola. Ace McWicked 01:18, 30 March 2009 (UTC)
If God has the power to create and flood the Earth, I think it's safe to say God has the power to naturally quarantine the ark's inhabitants. Historian 01:19, 30 March 2009 (UTC)
And all the animals? Also, how did Noah go about getting bacteria that thrive around Black Smokers in the deep ocean? And how were they housed and kept alive? Ace McWicked 01:20, 30 March 2009 (UTC)
Dissenting here :-P Can't almost all bacteria survive aqueous conditions. Viridae certainly can. And if not, survive on mountaintops or on Noah's ship's hull. :-) Taytopacket 01:28, 30 March 2009 (UTC)
Possibly however those deep ocean vent bacteria are extremely specialised and need sulphuric acid and extreme heat to survive. Ace McWicked 01:30, 30 March 2009 (UTC)
Wouldn't deep see bacteria survive anyway? Taytopacket 01:33, 30 March 2009 (UTC)
But I thought the point was that everything outside the ark dies and god starts again by wiping everything else out. Ace McWicked 01:35, 30 March 2009 (UTC)
But doesn't he kill them by (mostly defensive) weapon of water? So water-borne creatures survive. Taytopacket 01:39, 30 March 2009 (UTC)
Then if some things survive the flood without being in the ark does that not then violate what is written in the bible? Ace McWicked 01:41, 30 March 2009 (UTC)
That's why prawns aren't kosher. Czech-mate. :) Taytopacket 01:46, 30 March 2009 (UTC)
And won't someone please think of the plants?? Pink(Inertia presides over burnt modernist strides) 01:41, 30 March 2009 (UTC)
The plants were fine. They were all huddled on mount Arafat Arrarat.Taytopacket 01:46, 30 March 2009 (UTC)
First things first though - about the bacteria/viruses? Ace McWicked 01:44, 30 March 2009 (UTC)
Yes, and what if you were a bacterium that didn't live in the immediate vicinity of chez Noah. I mean I can understand how most of the animals got there - they walked (or slithered or flew). But what if you were the Ebola virus and you lived on the other side of the world? How do you get to the Ark? Also, are viruses even alive? Do they qualify for a place on the Ark? So many questions. --Horace 02:26, 30 March 2009 (UTC)
ebola and many other viruses and bacteria could have survived in the host animal on the ark. After all there were up to 7 pairs of some animals brought on the ark. If a few died soon after landing its not a big problem. The bacteria or virus , like anthrax may have remained dormant in the soil , in a mass of floating vegetation or etc etc . Its not the biggest problem in the global flood theory. If you assume the oceans were shallow and only small hills existed then the amount of water is easily dealt with. The collapse of subteranean aquifers (fountains of the great deep) would cause the collapse of the ocean floor, creating a drainage basin , and perhaps triggering an uplift of land , and /or continental drift. Hamster 02:43, 30 March 2009 (UTC)
Most of the dangerous viruses were likely not around at the time of the flood.
The ark only carried land-dwelling, air-breathing creatures. Sea creatures didn't need to be on the ark. Many would have died in the flood, and some may have become extinct, but enough would survive to repopulate afterwards.
Many plants/seeds could survive on floating mats of vegetation, which could also have been home to insects, etc.
Philip J. Raymentdiscuss 02:50, 30 March 2009 (UTC)
Why would you say that "Most of the dangerous viruses were likely not around at the time of the flood"? Thats a rather bold claim with no evidence what so ever to back it up. Ace McWicked 03:54, 30 March 2009 (UTC)
If creation was "very good" (i.e. without any defects, diseases, etc.), and if therefore dangerous viruses were once good viruses that have degenerated over time, and given that the flood was much nearer creation than 2009, why would you presume that most dangerous viruses were around at the time of the flood? Philip J. Raymentdiscuss 09:18, 30 March 2009 (UTC)
You say presume however you dont answer my question, and since the fall death was introduced into the world meaning then there would have been dangerous viruses and bacterias. How did Noah manage to get all the viruses, and bacteria, needed to repopulate the earth? Where did they come from (and how did they arrive) and where were they stored as many need very specialist environments. Finally to this (being in NZ its nearly sleep time for me) why do you think that a virus become dangerous is "degenerated"? If anything they have evolved to be able to attack/feed more effiencientlyAce McWicked 09:25, 30 March 2009 (UTC)
I did answer your question. Viruses would have started mutating (and therefore degenerating) at the Fall, but it would have taken time to accumulate very many. Also, it's theoretically possible that none did survive the flood, and all the ones we have now have come about (by further mutation/degeneration) since the flood. You haven't actually demonstrated that any existing harmful virus predates the flood. Furthermore, your argument is really only about fatal or very bad viruses here. Theoretically, some mild ones could have survived on ark passengers.
In answer to your last question, firstly that's what must have occurred given the original perfect creation and the existence of harmful viruses now. Secondly, do you have any evidence of increasing genetic information in the viruses? Philip J. Raymentdiscuss 12:15, 30 March 2009 (UTC)
@Philip - I have never understood the vague and ambiguous term "information" that creationists throw around so I'll by-pass that however, you state that by mutating the virus is degrading. But how do you explain a virus, like bird-flu, as degrading when it mutates to not only infect birds but also humans? Because that is certainly not a degradation as far as the virus is concerned. It helps it spread more effectivly (particularly if it evolves to spread human to human) and also allows it more hosts to live in. That is not a degradation at all. Ace McWicked 19:58, 30 March 2009 (UTC)
Something less specific has less information. The virus was specific to birds, but it is now less specific, and can affect humans also. Philip J. Raymentdiscuss 05:50, 31 March 2009 (UTC)
So what you basically saying is that something that can adapt to survive in a variety of environments lost "information" or "degenerated"? And what your saying doesnt make any sense because it can still effect birds AND humans, so nothing is lost - only gained.Ace McWicked 06:05, 31 March 2009 (UTC)
Read it again: it has lost specificity. Philip J. Raymentdiscuss 09:47, 31 March 2009 (UTC)

Unindent, Philip do you know what has to be involved for a virus to mutate to infect a total different organism and retain what it needs to infect its original host? Yes, it may lose specificity but it has picked up the ability to bind to the new organism's cells which requires a change in its genetic make up if it did not original bind. If anything this is a wonderful example of a virus evolving to become more prolific. I will also bet that the genome for the mutated virus is a little larger as well.--Timsh 14:14, 31 March 2009 (UTC)

What it has done is change in such a way that the body's immune system no longer recognises it. That doesn't need to be by an increase in information. See here for more on this. Philip J. Rayment

discuss 23:34, 31 March 2009 (UTC)

Alright then Philip, but when it changes to be able to be spread not just from chicken to human but from human to human then it has changed to the point it can no longer be spread to chickens. In other words it has evolved to be human specific. Ace McWicked 23:40, 31 March 2009 (UTC)
So it is no more specific than it was before? Does it contain any new information? Philip J. Raymentdiscuss 00:07, 1 April 2009 (UTC)

This discussion is continued below at #Viruses.


"information, information"? What the? It has obviously gone through a dramatic change and become something different than before. It has gained the ability to first infect humans then further gained the ability to jump from human to human but no longer from human to chicken. You think that it is losing something? Or staying the same? No, neither. Ace McWicked 00:16, 1 April 2009 (UTC)
Why does being able to infect humans mean that it's gone through a dramatic change? For all we know it might be a very small change. And has it really gained an ability, or has it changed in a way that the human immune system no longer recognises it? Philip J. Raymentdiscuss 04:36, 1 April 2009 (UTC)
You are saying that a virus has changed into a form that the immune system does not recognise but no virus, be it the common cold or HIV is a virus that the body recognises. Hence getting sick. Because the body does not recognise it and produces anti-bodies to defeat it. Once the anti-bodies are there and the body recognises it, then you can no longer get sick from it. To use your words Philip - "has it changed in a way that the human immune system no longer recognises it?", yes it has. Because it changed. Welcome to the world of evolution. Ace McWicked 06:21, 1 April 2009 (UTC)
Classic equivocation. Here CHANGE(any)=EVOLUTION (definition one), therefore since CHANGE is observed, EVOLUTION (definition eleventy something) is true. For an example of change/loss (and one touted as evolution) take resistance to antibiotics. There is a "super-staph" that is extremely resistant to antibiotics that usually affects hospital in-patients. This is because anti-biotics kill off the regular "staph" infections but the "super" strain has lost metabolic ability and thus is less effected by the anti-biotic. Free from competition, the "super" strain runs rampant. The best treatment? Go into the outside world and get exposed to the regular strains, which will very rapidly outcompete the "super" strain and in some cases eliminate it entirely. Another round of antibiotics kills of the regular strain quite readily. The "super" strain has lost adaptability, as it is only selected for in a very specific and hostile environment in which its poor metabolism is no longer a handicap.BradleyF (LowKey) 06:36, 1 April 2009 (UTC)
BradleyF, this is very different to what I was discussing with Philip as I was talking viruses and not bacteria. I would also like to add that what you have stated is, well, gibberish. I would like to hear from Phiip re: what I stated above. Ace McWicked 08:59, 1 April 2009 (UTC)
From me? BradleyF said it very well. It's not gibberish at all, and the example of the bacteria is a valid analogy. Philip J. Raymentdiscuss 09:38, 1 April 2009 (UTC)
I give up, hands in the air. If you morons people seriously believe that a virus changing to infect different hosts is an argument against evolution then all rational discourse from this point is utterly pointless. Ace McWicked 19:46, 1 April 2009 (UTC)
I guess it is pointless when your argument descends to your position being self-evidently true and you resort to namecalling. Philip J. Raymentdiscuss 02:41, 2 April 2009 (UTC)
What BradleyF said was nonsense. The only strain of "Super strep" I have ever heard of is Methicillin Resistant Staph Aureus. Which is not resistant to anti-biotics because it has lost some ability to metabolize them. No staph ever had the ability to metabolize them, that is why anti-biotics work, they are poison. Methicillin Resistant Staph Aureus gained a modified penicillin binding protein, essentially making most anti-biotics harmless. This modification was determined to have been brought about by insertion mutations (the gain of a/(or multiple) ATGorC) and horizontal gene transfers. The same goes for Super TB, it has gained a resistance to antibiotics without losing any kind of prior function. This pattern is seen repeated time and again. Things don't start out with a blank slate (I can exist anywhere) and then narrow down the possibilities (I can only eat lactose). They start with limited possibilities and change to what better suits their survival. Take E.coli. E.coli can digest lactose but generally not Cit. This is because they possess what is called the LAC gene (geneticists are clever namers right?) This gene allows them to digest lactose. Because they cannot digest citrate (they lack the CitT gene...again clever naming) it is common for biologists wishing to eliminate e.coli from a sample to grow bacteria on Citrate plates. When E.coli change to be able to consume Citrate, they are not losing the LAC gene, they are gaining the CitT gene. You also see this in Nylon-eating bacteria. Now, you may say that since they are no longer specific they have lost information, but in that case your definition does not match anything regarding genetics and evolution and has no proper place in an argument against such. --ScottA 11:58, 1 April 2009 (UTC)
Perhaps BradleyF got a term wrong here or there, but that doesn't mean that it's "nonsense". For a more accurate explanation, see here. Philip J. Raymentdiscuss 13:02, 1 April 2009 (UTC)
I have read Wieland before and I am not impressed. He is a 20+ years retired MD who has not published anything in a well known science journal since at least the 1990s. The source itself is poorly sourced with a number of unsorced anecdotes (the plural of anecdote is not evidence). While I would normally conceede that he has more experience than I do and should know what he is talking about, he completely neglects a good number of different mutation types (he doesn't mention some at all) and his explanation of mutations, gene transfer, and evolution are vague enough to be considered inaccurate. Even going by the sources he provides. They are outdated...and yes, 6 years in a biology field dealing with a problem as large as "super bugs" is long enough to start considering the paper outdated. His tone in discussing super bugs and his "roll in the dirt" treatment is another red flag. Every modern paper or doctor i have read or talked to, would never treat such a serious problem so lightly and I am willing to bet any doctor who told a sick patient "to go roll around outside" would but up in front of an ethics committee.--ScottA 14:13, 1 April 2009 (UTC)
Wieland has published in the Journal of Creation in recent years, and whilst you might not consider that "well known", that is hardly the point, and for most people most science journals would not be "well known" anyway. Beyond that you accuse him of being vague, yet you dismiss him with sweeping generalities yourself. As for rolling in the dirt, he was quoting other people; it wasn't his comment, and keep in mind that this article was for a lay audience. Philip J. Raymentdiscuss 15:05, 1 April 2009 (UTC)
@Hamster: Weren't they floating around for 6 months? I wouldn't like to floating around for 6 months with a group of animals infected with Ebola virus. It seems to be the sort of illness that kills one sooner rather than later. --Horace 05:29, 30 March 2009 (UTC)
Hehe, he said mats of vegetation. Most insects have very specific requirements to live, and hovering over decaying plants on the ocean surface is most notably not among them. ħuman Number 19 05:44, 30 March 2009 (UTC)

(unindent) What strikes me is the extraordinary inefficiency of this flood idea. What was God thinking? If he wanted to kill all of mankind (excepting Noah and family) why didn't he just smite them. Bang! On the spot. You're smote buddy. Surely that would have been the way to go. Why muck around with flooding the place for six months? It all seems rather odd. And now we are told that various animals and bacterium could have survived outside the Ark in the soil or on mats of vegitation. Well if insects could have survived on mats of vegitation what about small mammals? What about larger mammals? What about people? After all I don't suppose that the Ark was the only boat around. I mean, it rained for 40 days and 40 nights. Did no-one else think of getting into a boat? --Horace 09:57, 30 March 2009 (UTC)

Nobody else would have had a boat capable of riding out the rough seas for so long (actually nearer a year) and the foresight to stock it with provisions for that long. And it didn't rain for 40 days and 40 nights before the flood (as a warning), but as part of the flood event, which also had the subterranean water bursting out. So although people living on the coast could probably have made it to boats already there, it's not as though they had much warning. Except for Noah's preaching of course, but they ignored that. Philip J. Raymentdiscuss 12:15, 30 March 2009 (UTC)

Horace, there is also a Christian symbolism in the Flood. The boat represents the Church, which is the vessel of salvation today. The symbolism is not there if God used another method. AddisonDM 20:18, 30 March 2009 (UTC)
God flooded the planet for the sake of a leitmotif?! --Robledo 20:25, 30 March 2009 (UTC)
But God hadn't invented the Church - or even salvation - at the time of the Flood. ħuman Number 19 00:20, 2 April 2009 (UTC)
That's exactly the point, it prefigures the future Church. There is a storehouse of foreshadowing and prophecy in the OT like this. AddisonDM 02:46, 2 April 2009 (UTC)

Viruses

This discussion continued from within the parent section.

There seems to be a lack of understanding when it is about cellular transport. A virus can not just lose something to cross a cell membrane. The only exception to this is prions where the bare protein has its charge masked. Viruses have charged proteins on their viral coat (the shell outside of the virus) that are specific to some proteins on the outside of the host cell. Molecules can only diffuse across the membrane if they carry no charge or have an active transport pathway to follow. This means that most viruses have to bind to a protein on the cell surface to enter the cell (to cause membrane encapsulation). Only through this bonding of proteins can the virus attack the cell (this is one of the ways some antiviral drugs inhibit infection). The problem with the situation above with the birds and humans is that the virus would have to mutate and have some protein that would allow it to bind to a receptor on the host human's cell. For the virus to still infect chickens and birds it would have to retain the non-mutated protein as well as the mutated protein for attacking humans. I read the AIDS article, written by Carl Wieland, and have to say his understanding of virology is limited. Perhaps it may be from the advances in the past 20 years of retrovirals that has helped scientists understand the immunological aspect or just the additional published data that is out there, never less it would not be a good idea to use him as an end all source when he does not even cite a single reference, beyond the creation website and the aids factsheet from NIAID. For example, he left off the mention of the different clades of HIV and that HIV and SIV are very similar with key protein differences. He failed to mention that the sequence of the different types of HIV has been understood for years and that there are differences in the proteins that are expressed, differences that make the virus more aggressive in infecting its host. When he answers the question has AIDS evolved he fails to show any hard evidence as to why he believes it did not. His defining a virus as living or non living really does not matter due to the issue being the virus genetic material (which we know can and will change). He fails to comment that viruses have daughter viruses, they just use the machinery of the host to produce them (this by the way has been shown true through isotope labeling of virus DNA with N15 collecting the daughter viral DNA after it has been synthesized, in a CsCl gradient which gives you a hybrid, original and 2nd generation daughter DNA. Which shows that viral DNA, not just the code but the original DNA molecule, does pass to a future generations, thus establishing the ability to trace a genetic line in viruses. By Wieland avoiding to mention this allows for his claim that "Viruses can have no evolutionary relationship to any other form, and so whatever may have happened to say, the AIDS virus, has no relevance to the supposed history of truly living organisms in any case." to stand in his article even though it is false. His second claim "An apparently major effect is probably caused by only a horizontal or even a negative change in informational content, and therefore does not relate to the sort of evolution postulated generally. It certainly does not involve any increase in functional complexity." is illogical. If x+y=z then a+x+y=z is false, but a+x+y=z+a is true. Meaning that if a horizontal change in informational content (caused by lateral gene transfer) and that informational content was not in the organisms to begin with, then it is a net increase in informational content of the organism. Let me know if you disagree with the logic and the statement.--Timsh 15:14, 2 April 2009 (UTC)

Thanks for that extended explanation of how these things work. Indeed, some of that information from CMI is a bit old, and ongoing research might well have thrown a lot more light on what actually happens. Also, as I explained above, the article was for a lay audience, so would have been deliberately non-technical. Further, the HIV article (from memory) was addressing the question of whether viruses can be invoked to explain the origin of life, not the question of increasing or decreasing genetic information.
All that said, I can't see that you've unequivocally shown that any viral mutations constitute an increase in genetic information.
By way of background, I've frequently seen evolutionists claim that some mutation constitutes an increase in genetic information, but upon further investigation it turns out that this is not (necessarily) the case at all. Often it's a case that they consider a mutation to generate new information by definition, which is tantamount to saying that a typographical error is by definition going to increase the information content of the document, rather than recognising that in most cases the error will reduce the information content. So I don't accept claims of mutations causing increased genetic information readily. But that is a generalisation; each individual claim still needs to be checked.
And much of your explanation is useful in understanding the mechanism, but is very light on actual argument that there has been an information increase. You talk about SIV and HIV being similar, sequences being understood, and various differences, but where's the evidence of an information increase?
I believe that you have misunderstood Wieland's sentence that you describe as "false". I believe that he was talking about its relevance to the origin of life, not to whether viruses can have an ongoing genetic influence on truly living things. Part of the reason I say this is that creationary scientists have proposed that passing fragments of DNA from one living thing to another in a helpful way was the original (created) purpose of viruses, but some have deteriorated so that they are now harmful.
His second sentence that you quote is not illogical, and your analogy is flawed. He is not saying that x+y = a+x+y; he's saying that x+y is no more complex than a+y, where the x has changed to a. (And that's ignoring that x+y = a+x+y if a=0!)
And finally, a lateral gene transfer is a transfer of existing genetic information, not the generation of new genetic information. Yes, there may be an increase in the information content of the particular organism, but that doesn't explain what generated the genetic information in the first place.
Philip J. Raymentdiscuss 08:00, 3 April 2009 (UTC)
Thank you Philip for the thoughtful response. The HIV article listed was about if HIV had evolved not about a role viruses may have played on the origin of life. This was the reason I was as critical of it compared to an article that would have been based on speculation, the role of viruses on the origin of life.

Now on to the meat…

Genetic information is based on the number of genes that encode actual proteins. Information is not only defined as content but also context, therefore a change in gene expression of a protein compared to the regulated concentration of a protein would be an increase in information. This is not only true when you use the example of “A very large dog chased me home.” Compared to “A very very large dog chased me home.”, but it is also true when dealing with gene regulation. A good example is insulin regulation by the beta adrenergic receptor. This shows the impact of a change in concentration due to gene expression being increased, which can be caused directly by an insertion or duplication mutation.
HIV-1 and Vpu is an increase of genetic information in the form of a gated ion channel found in HIV-1 but not in HIV-2.[3] [4] [5] [6] Vpu allows for HIV-1 to bypass much that hinders HIV-2. The sequenced genome of HIV-2[7] and HIV-1[8]. As you can see HIV-2 has 8 genes whereas HIV-1 has 9 genes. This increase in the gene count by one has allowed HIV-1 to become more infectious than HIV-2 thereby giving it an advantage. Would you consider this an increase of information? (8 original HIV-2 genes + 1 new gene = 9 genes in HIV-1 that allows for it to infect its hosts better).
I do not believe that Wieland was working under the context of origin of life when his paper dealt with just the evolution of HIV. As for LGT being helpful, that would be speculation for any side to say (speculating the intentions as good or bad is a stretch).
Awh but it is flawed, he fails to point out what I did at the beginning of this post about concentration differences causing different effects. If it was as simple as x=a then there would be no argument, however this assumption is only correct when the mutation is a point mutation. In most cases it is [x] + [y] =[z] which is the concentrations of x and y equal the concentrations of z. Most mutations are insertions due to retroviruses or transposons which move whole genes around. So there are a few cases where x = a, but most cases this is not true leading to changes in the organism.
What generated the change in information is mutation. Take for example these two sentences; “John has a green car.” and “Sue wears a Pokka dotted dress.” Now to mimic LGT we can form “John has a Pokka dotted green car.” The sentence becomes more specific. Now add this to what I stated above regarding concentration and you soon see how all of this can lead to mutations that lead to phenotype changes that lead to speciation.
Something that seems paradoxical to me is that there is an argument about this in the first place, from the creationist materials I have read I understand that microevolution is accepted and that it is only the step from one species diverging into another that is in question in the minds of creationists. If I am incorrect please inform. If this is true then what is the basis for the creationists not accepting that a large number of genome mutations can lead to speciation? Is it a matter of time? (Which would make the most logical argument from the creationist POV) I have seen computer algorithms that generate sentences from random letter sequences, why is it such a big leap to understand that the genetic code is very similar (but also that its size can change as well)?
Just to throw this out there. Sickle cell anemia is caused by a point mutation. However the humans that are heterozygous with this mutation, only occurring on half their genes, are better able to fight off malaria compared to those without the mutation. Homozygous people tend to die off early due to this. Now, understanding that you have three options, ++, +-, --, and by using simple genetics you have a chance of 25% of being ++, 50% of +- and 25% of --. With that being said the -- and +- have no adverse reaction from the mutation and the +- gains the resistance, therefore they can pass on their genes. As you can see this is the basis of evolution, a change over time. With 75% chance of the children born from this couple having no adverse affect from the mutation, even though the mutation is harmful, it provides a long term benefit to those who are mixed and allows the genes to be carried forward, thus allowing for those humans to have an evolved way of avoiding malaria from killing them. Now is this speculation? Not really there are many blood clotting conditions that can be traced back to certain populations, many of these clotting conditions are beneficial to the human allowing for their diet to be more flexible. Lactose tolerance is another example.--Timsh 22:02, 3 April 2009 (UTC)
No, genetic information is not based on the number of genes; it is based on the meaning of those genes. It's like saying that a longer sentence has more information simply because it has more words, whereas the amount of information depends on what those words are saying. So "My female sibling owns the building in which she lives" has no more information than "My sister owns her home". Therefore, it doesn't follow that "a change" is equivalent to "an increase".
A change in quantity is not an increase in information either. "Very large" could be represented by, say, "70% maximum possible", and "very very large" by "90% maximum possible". So changing "70" to "90" is certainly a change, but it's not adding new information.
Regarding HIV-1 and Vpu, you haven't put this to me before under a different name at a different site, have you? Because someone did, and I asked Creation Ministries about it, and here was their reply.
I wasn't saying that x=a. I was saying that x+y is no more complex than a+y. It's like the difference between "John had a red book" and "John had a blue book". Which sentence tells you more? Neither; they both have the same amount of information, just different information.
Which sentence became more specific? The "John has a green car" sentence, or the "Sue wears a Pokka dotted dress" sentence? More to the point, you designed it to be that way, didn't you? That construction was not the result of chance/mutation.
As I wrote in response to someone else in the last day or so, along with leading creationists, I don't use the terms micro- or macro-evolution, as they are misleading insofar as the actual issue is concerned. The issue is not the amount of change, nor speciation itself (that is accepted), but the direction of change (increasing vs. decreasing information). See here for a much fuller explanation.
Regarding Sickle cell anemia, what you've not shown is that the mutation provides any increase in information. True, for those who are heterozygous, it does provide a benefit, but "benefit" does not equal "increase". Sometimes it's possible to benefit from a defect, and that is what has happened in this situation. Also, as you skirt around, the benefit is only in a particular circumstance (exposure to Malaria), and for 25% of the population, the result is a serious problem. No, change over time is not the basis of evolution. Goo-to-you evolution (i.e. the evolutionary "family tree") will not occur if the change is downhill, only if it is uphill. So uphill change over time is the basis of evolution, and that is what has not been observed. Only downhill change has been observed (i.e. decreasing information). See here for more on Sickle cell anemia.
Philip J. Raymentdiscuss 07:53, 5 April 2009 (UTC)
Whereas I agree that the meaning of the gene is important but the number is important as well, if you need three screws to attach a faceplate on a watch then the number of screws is as important as the screw itself. To relate this to molecular genetics, gene regulation is often done through feedback inhibition. In other words once a gene has been expressed, the expressed protein actually changes the future expression of the gene, either increasing or decreasing expression. This is how the concentration matters. Consider that these proteins do not suddenly go to the area where they are needed within the cell. They must have a certain concentration to perform their functions. If these concentrations are off then the reactions these proteins catalyze will not happen when they need to.
Change in quantity is an increase in information. We are dealing with chemical reactions where not only reactants are important but the concentration of the reactants is as well. Consider the concentration of Ca2+ in a cell (10-7 to10-5 M), if the Ca2+ concentration increases in the cell phosphates precipitate and eventually apoptosis occurs. So an increase in quantity does change information.
HIV, I am aware of able806 over at CP who did bring this up. I pity him, because it is an uphill battle for him there. On to the topic, interesting read although the creation.com did not address the differences in the Vpu protein found between the HIV and SHIV strains. The HIV-1 [9] has 249 bp while the SHIV [10] has 246 bp. I decided to help out a bit with the actual sequences. As you can see they are not the same sequence.
HIV-1-ATGCAACCTATACAAATAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGC
SHIV-ATGCAACCTATACCAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTG
Furthermore, the Vpu is not found in the majority of SIV but only a couple of strains (suspected to be evolved). It is believed that the development of the Vpu is based on a mutation of a duplicated Vpr gene (found in SIV and both HIV1 and 2). Consider that the size of the HIV-1 Vpr is 292 bp and Vpu is 249 bp a difference of 43 bp. SHIV’s Vpr is 306 bp and Vpu is 246 bp a difference of 40 bp. This is a prime example where a suspected duplication and mutation has changed the function of the virus. I know you shall claim that there is no new information because you see that Vpu is smaller than Vpr however when taken in content with the genomic sizes there is not only and increase of information but an additional amount of codons in the genome due to the duplication. Perhaps the creation.com scientist who reviewed the literature should look at the sequence information (evidence) before dismissing the claim.
Different information does matter when it comes to offspring, that is why the context of x+y and a+y is more complex. Yes, I designed the sentence as is needed when giving examples however there is plenty of evidence of random mutation to support the concept and example.
As far as micro evolution, I read the article however it is based on the idea of no “new information” occurring. I am unsure how to convince someone that this in of itself is a false concept other than by providing examples like above and the one I am about to provide now. Divergence is when a population splits and the genetics in the population changes from the original population. We will use Richard Lenski’s work as an example, his E. coli study showed that the E. coli became able to metabolize citrate over several generations compared to the other E. coli. I know that creation.com had an article however they have yet to update it with the findings by Lenski that the ability for the E. coli to metabolize citrate was found in mutations of pykF and nadR genes, not by turning of the specificity switch of the tartrate transporter gene (TtdT) as proposed by creation.com. Here is the point, there were mutations that lead to the E. coli being able to metabolize the citrate without doing any other observed changes to the bacteria and the other colonies remained the same thereby showing divergent evolution. The mutated E. coli could still metabolize the original media as well as metabolize the citrate. There was an increase in genomic size of the mutants as well as retained function from the ancestral population. Seems to me to show that something increased.
Sickle-cell, awh Philip this is why I talked about phenotypes. You see heterozygous people received the advantage of the mutation, while not receiving the side effects, and are also a greater percentage of the possible births of the genetic carriers, thereby allowing for the population over time to have the gene but not the anemia. As for information the heterozygous people have two forms of the hemoglobin gene, the one that encodes for hemoglobin A and the one that encodes for hemoglobin S (the mutant gene caused by a point mutation) this gives the heterozygous people an additional gene compared to non affected peoples, an increase in information due to an additional functioning gene.
Goo to you, I love that phrase. Mutation over time and natural selection are the basis of evolution. Consider this, primordial organisms mutate at a greater rate than newer forms due to the newer forms having proofreading proteins that make corrections when there are certain types of mutations. E. coli is actually a newer organism compared to bacteria found in undersea vents. There are no studies currently using those primal forms of bacteria however I would not be surprised if the divergent mutations occurred much faster than what Lenski saw with his E. coli experiment. With that being said, we have seen mutation arise and change the abilities of the organism and based on observed genetic drift we know that certain mutations can spread through the population (concepts that have supported evidence). The only two factors that creationist truly disagree with evolutionists on is a matter of time and what constitutes information. Personally, I believe that when a mutant forms yet retains original function while gaining some other function through the mutation that it is “New information”. As for time, well geology seems to answer that (I find rocks pretty boring).--Timsh 13:51, 7 April 2009 (UTC)
The number of genes is irrelevant if there is no change in meaning. And the change in meaning needs to be in the direction of greater information for evolution to work. Yes, concentration is important, even vital, for things to work, but a change in quantity is not new genetic information, in the sense that there are now instructions for something for which there were no instructions before. It's like a car manual having a change to the tyre pressure. Such a change might result in a better pressure that allows the tyres to last longer (although it's more likely the change will be for the worse), but such a change is not going to result in the car being able to climb walls, or fly, or anything that's on the way to changing the car into something else. So no, a change in quantity is not an increase in information, even though it is a change in information.
No, I wouldn't claim that there's no new information on the basis that the sequence is shorter, because the amount of information is not necessarily related to size. You say that there is an increase in information, but later acknowledge that you are using a different definition.
I don't follow your sentence about different information mattering and how that makes a+y more complex that x+y. Where's all this "plenty" of evidence supposedly supporting an increase in information? Apart from a very few rare and disputable examples, there is actually an extreme paucity of examples, and that's the point. But then perhaps it's got to do with different definitions.
It's hard to convince someone that they are wrong about there being no new information when your counter-examples don't really show new information. And when you imply that an increase in genomic size equates to an increase in information when this relationship has already been refuted is not conducive to winning the argument.
You've lost me with the sickle-cell response. I fail to see how that shows that there was an increase in information rather than a defect. Then your argument from "primordial" and "newer" organisms presumes evolution to argue for evolution!
Okay, so "certain" mutations can spread throughout the population. But what mutations? Most such mutations are neutral.
Philip J. Raymentdiscuss 11:41, 8 April 2009 (UTC)
The number of genes is important since an increase in genes is an increase in proteins able to be made. I am not sure if you assume that all proteins are alike but to make a claim that the number of genes is not important is like saying that the number of letters in a word do not matter. I do agree that evolution is based on the concept of greater genetic diversity through mutation, meaning that there would have to be an increase in genes for evolution to happen, but I also disagree that this is the only direction to evolve an organism since removing a function would change the organism as well.
Concentration, I recommend reading some information about gene regulation when talking about this. Concentration is as important of a variable as the gene itself. Concentration can turn on and off genes; therefore if you have an increase in concentration due to a repeat in a sequence through a mutation you do have a change in information. For example, bone density is based on genetics, how the proteins cause an increase in calcification of the bone reinforcing its structure. So you have a repeat mutation of a gene that causes the production of more of the protein that supplies calcium to the bone tissue, resulting in an increase in bone density. This affects the organism by decreasing their stature due to the increased mass of the bone on the growth plate retarding normal growth. Essentially the organism’s height has decreased but their bone density is high, reducing chances for breaks and allowing for muscle tension to be applied to the bone. All of these factors contribute to a physical change in the organism, just because of an increase of a protein. Your tire pressure metaphor is correct but you failed to see that better pressure extends the life of the tire significantly, thereby changing what is considered normal.
Information is based on the number of genes. Exons and introns, are key when talking about DNA. Exons are used to code for RNA to protein while introns are not known to encode during transcription. So the length of the genome is not as important as the number of genes contained (since not all of the genome is transcribed). If I said differently it may have been due to this piece of information.
Examples, Philip go to pubmed and do a search and then compare the genomic structures of the organisms, you will find more than enough evidence to support the claim of an increase in function is relative to the number of genes.
Perhaps I should make myself clear, genomic information is not the size of the genome but the number of genes it contains. A sequence of DNA is not the same thing since not all DNA is transcribed. Infact only 30% of the human genome encodes for actual genes.
My counter example shows no new information? I provided you with a sequence, the sources of the sequences and explained the differences in function due to the change in sequence, where the gene is thought to come from, and showed an increase in the number of genes compared to the increase of function by the organism. There is not much more I can do since the only way to detect mutation or increased genetic information is by looking at a gene and sequence. If you need help in understanding this, I will try but it is very clear from my example of Vpu between HIV-1, HIV-2 and SHIV that there is an increase in genes (genetic information) and obvious function that is not even based on concentration.
Sickle-cell the homozygous people would only have either two of the normal genes or have two of the mutant genes in their genome (consider that most genes in humans are paired). The heterozygous person would have one mutant gene and one normal gene, thereby having 1 extra piece of gene information. This is true due to gene regulation, once the hemoglobin hits a certain concentration one of the genes is no longer transcribed. Since in the homozygous people the other gene would just be transcribing the same protein just at a different concentration there really is no change of function. However in the heterozygous person you have the mutated Hemo-S and normal Hemo-A being transcribed. So two different proteins that have slightly different capabilities. This is a prime example of an increase of information. This was also the reason I went into detail about the homo and hetero aspects of all of this so you could see the difference. What you see as a defect is, in the homo groups, in the hetero groups it is an advantage since they are resistant to malaria compared to other humans with out the side effects of the homo groups.
Most mutations are considered neutral due to our lack of understanding what the mutation actually does. We have found many medical cases where harmless mutation was the cause. As for what mutations, look around. If everyone had the same genome we would look exactly the same. It is by mutation that we are different. Read up on the genes that cause red hair and see how red hair is not likely to exist in humans in a few centuries. This does not seem to be a big thing but it is evidence of genetic shift, which is evolution in progress.--Timsh 14:57, 8 April 2009 (UTC)
The number of letters in a word don't matter. What matters is what the words say. That is, what concepts the words represent. Does "automobile" (US) have more information than "car" (Aussie)? Does "casbver" have more information than "car"? "casbver" has no information, as it's a random sequence.
Yes, organisms change by losing information, but that sort of change won't turn bacteria into butterflies, which is what evolution proposes.
I'm sure I've answered the concentration point before, but perhaps it was not with you. Yes, an increased concentration is a change in information, but it doesn't add anything new.
No, I didn't fail to see that a change in tyre pressure might extend the life of the tyre: In fact that is what I said, and also pointed out that that was not the sort of change that evolution requires.
No, information is not based on the number of genes, but the meaning carried on those genes, as per the number of letters example at the start of this post. And that applies to the number of genes just as much as the number of letters.
Your counter-example failed to actually demonstrate new information because it was wasn't talking about the meaning of the genes.
With sickle-cell, the "extra piece of information" is a defective gene; a loss of information; a copying mistake. Your argument about the defect being an advantage indicates that in particular environments this loss of information can be an advantage, but that doesn't mean that it's an increase in information.
Your argument that mutations is what makes us different is, on one level, false, and on another level, begging the question. That is, it's not because of mutations that I look different to my parents and my brother; it's because of recombination. As for whether mutations originated the variations, that's what evolution claims, but creation claims that God created the variation. You are asserting the evolutionary view as fact. If red hair (caused by a defect) is going to be eliminated in a few centuries, why has it become reasonably widespread? Why has it spread as widely as it has if it's being selected against?
Philip J. Raymentdiscuss 14:00, 15 April 2009 (UTC)

To respond point by point:

  • The number of letters in a word don't matter. What matters is what the words say. That is, what concepts the words represent. Does "automobile" (US) have more information than "car" (Aussie)?
I agree with your statement when discussing linguistics, however molecular genetics is far more complicated. You apply the stigma of meaning, when talking about genetic information meaning is based on the expression of the gene, either it expresses (has meaning) or it does not. That is about as simplified as I can make it. Just by the gene expressing the protein gives meaning to the protein and thus the gene. To support this consider that proteins are not created from a vacuum. To produce a protein energy must be used as well as the building blocks of the protein must be available and in the end you find that these resources are no longer available for other processes. This gives meaning to the gene and protein since it is causing a change in the biochemistry of the cell by changing the concentrations of resources which impacts the cell thus giving meaning in the view of the cell. For us it may not have any long term impact that we can detect, however it does not prove there is no meaning.
  • Does "casbver" have more information than "car"? "casbver" has no information, as it's a random sequence.
In the context of English, no it has no more meaning, in the context of genetic code yes it does. Each amino acid has different attributes, switching one for other causes a change in the protein, sometimes very small other times very large. Let us use a watch metaphor, if you take out a gear and replace it with a gear that has a few more teeth per turn you will see a change. When dealing with amino acids this is very much the same. Some proteins are built with highly specific active sites that a change in the amino acid causes the protein to lose its function. However, there are cases where the amino acids in the protein can be switched out due to the purpose of those amino acids is just fro structure not for chemical interaction. Also, you have to consider the factor that the structure is important due to if the atoms are to far apart the chemical reaction will not occur causing the protein to not function, and the opposite can be said as well. Take these two example in consider consideration, in the Krebs cycle Citrate synthase forms Citrate from oxaloacetate and acetyl-CoA [[11]]. The mechanism is highly specific and requires positioning for the reaction to occur. Changing the structure of the enzyme would change its function. The second example is the Klenow Fragment, it is formed when DNA Pol1 is mutated. It shows that function of enzymes can be conserved even with the removal of parts of the original enzyme. This shows that it is not just the genetic code that affects the function of proteins and thus genetic information with respect to phenotype.
  • Yes, organisms change by losing information, but that sort of change won't turn bacteria into butterflies, which is what evolution proposes.
Organisms change by adding information as well, Down syndrome and some types of dwarfism for example.
  • I'm sure I've answered the concentration point before, but perhaps it was not with you. Yes, an increased concentration is a change in information, but it doesn't add anything new.
This depends on context; I gave you an example above where an increase in the production of a protein can cause morphological changes in an organism. The new is based on the morphological change not the actual repeat of the gene. I assume the confusion is that you see New as only being able to be introduced by god whereas I see new as a change from the norm, hey you bought a new car. I believe this is due to the concept of origins. You do not believe that something can originate without godly intervention; I believe that is not the case. Therefore, a new trait to you has to be introduced by god whereas I see a new trait as being something caused by a genomic change.
  • No, I didn't fail to see that a change in tyre pressure might extend the life of the tyre: In fact that is what I said, and also pointed out that that was not the sort of change that evolution requires.
I acknowledge you said that, and it is indeed the steps that evolution requires. Evolution is about progressive steps. An organism living longer often gives it an advantage over those that do not.
  • No, information is not based on the number of genes, but the meaning carried on those genes, as per the number of letters example at the start of this post. And that applies to the number of genes just as much as the number of letters.
As stated above, meaning is determined if the gene is expressed or not. To express a gene changes the biochemistry of the cell, by changing concentrations of reactants or changing the amount of energy available to pull reactions to completion. It is pretty rare that a single gene will cause such a great change to cause meaning beyond the basic biochemistry of the cell, however an accumulation of those changes would. Just to point out meaning is a very poor argument since meaning is only applicable based on the context of the environment, meaning it is as much of a variable as the question of information.
  • Your counter-example failed to actually demonstrate new information because it was wasn't talking about the meaning of the genes.
    With sickle-cell, the "extra piece of information" is a defective gene; a loss of information; a copying mistake. Your argument about the defect being an advantage indicates that in particular environments this loss of information can be an advantage, but that doesn't mean that it's an increase in information
Let us use your term meaning here. The gene is defective when it kills the person. The gene is beneficial when it does not kill but instead provides protection against malaria. So in the context that the heterozygous person would have the benefit without the gene killing them seems to me to be beneficial. You see the gene as a defect however it is undeniable that the gene allows a heterozygous person to have greater resistance to malaria without hurting them like a homozygous person thereby having the meaning of being a benefit to those in malaria ridden places.
  • Your argument that mutations is what makes us different is, on one level, false, and on another level, begging the question. That is, it's not because of mutations that I look different to my parents and my brother; it's because of recombination. As for whether mutations originated the variations, that's what evolution claims, but creation claims that God created the variation. You are asserting the evolutionary view as fact. If red hair (caused by a defect) is going to be eliminated in a few centuries, why has it become reasonably widespread? Why has it spread as widely as it has if it's being selected against?
So you believe that the argument that mutation is what makes us different is false, to address this point I shall assume you are a Caucasian male (majority race in Australia) as such you believe, from your statement , that your genome is as similar to an Asian male in northeast China compared to a Caucasian male in England? It is a change in the genome (mutation) that gives the variety that we see in the races. Your statement about recombination is correct however the changes you see that cause the lobed ear vs. the attached ear, the freckles, ect. are caused by mutation. God created the variation, as you say, with that being said how did the different races of humans come to being from Noah’s family? Last time I checked the diversity of the human race includes traits such as skin color, skin folds, fat distribution, height and build, and not to mention all of the unique genetics found in individual family lines such as blood clotting factors. Did Noah’s family have all of these changes? Was one of Noah’s sons really a nilote and another a pygmy? On the topic of red hair, you said it was caused by a defect, did you not realize that all of the different shades of hair color is based on two chemicals eumelanin and phaeomelanin of which phaeomelanin is red? Based on known genetics you have two genes that control the hair color, one reduces the production of phaeomelanin causing the red tint to be reduced. If anything the defect is the non-reds since they are caused by the retarding of phaeomelanin, however this is an example of genetic shift, those with the gene that does the suppression happen to be a larger part of the population. To correct your assumption about the widespread of red hair, it is only in about 1% to 2% of the human population, it is a recessive trait that probability favors against.
--Timsh 17:48, 16 April 2009 (UTC)

Continuing with mutations and information

I don't know, language is pretty complicated too! But meaning of genes is not simply true/false based on their expression. To stick with the language analogy, what you are saying is that every possible combination of letters makes a legitimate word. And that is true. But not every combination of words makes a legitimate sentence. "for guest quick over manacle star" has no meaning, even though each word individually does. And not every combination of sentences makes legitimate paragraphs. You yourself point out that a change in the genetic code can produce a loss of function. Each codon still has meaning, but the resulting protein doesn't—it no longer has a function.

Down syndrome is caused by a duplication of existing information, there's no new information created. Duplicating existing information won't turn bacteria into butterflies.

I'm not defining "new information" as something that only God can introduce.

An organism living longer may have an advantage, but it doesn't turn it into something else. A longer-living dog is still a dog. A car with a longer-lasting tyre doesn't become an aeroplane. And neither are they small steps on the way to something else.

A beetle on a windy island that has a defective gene that stops it growing wings has an advantage in that it's less likely to be blown off the island. This is a benefit that can be selected for. But it was caused by a loss of genetic information. The sickle-cell mutation is similar. Just because it confers an advantage doesn't make it an increase in information.

Perhaps I haven't been clear, however. When I'm talking about an increase in information, I'm talking about the addition of new information. Just like obtaining a book about trains means that you now have more information about trains than you had before, but buying a second copy of the same book doesn't give you any more information than you previously had. Because there's no new information over and above what you already had.

As a Caucasian male, my genome might indeed be more similar to an Asian male than a Caucasian male from England. The genetic differences within a "race" are greater than the average genetic differences between "races".[12] So that was a poor example, but a poor example doesn't negate your point. Your point, however, is to merely assert that the "racial" differences are due to mutations, which apart from anything else, would be rejected by Occam's Razor because recombinations can adequately explain it. That's not to say that mutations have had no effect—red hair is caused by a mutation, apparently, and your other examples perhaps were—but recombination is able to explain a large part of it. For how the changes all came from Noah, see here. Did Noah or any family member speak a Nilotic language? No, multiple languages came in with Babel. Was Noah or any family member a pygmy? I don't know, but what is the genetic difference that makes a pygmy a pygmy? Perhaps that one is a mutation.

Regarding red hair, you are correct in your details, including that the defect is in the gene controlling the production of phaeomelanin. I wasn't trying to indicate that it was very widespread. I'm saying that if it didn't use to exist, and now does because of a mutation, how would it spread to even (as you say) 1% to 2% of the population, if it's being selected against? For more on red hair being caused by a mutation, see here and here.

Philip J. Raymentdiscuss 13:09, 22 April 2009 (UTC)

  • Philip, let us move from language to the real thing, proteins, even when they do not have a direct function, have some effect on the organism. For example Huntington’s disease, it is a dominant mutation that produces a protein called huntingtin. The disease manifests and progresses faster based on the number of mutated gene replicates found in the organism’s genome. These replicates are labeled as toxic fragments and based on their number the patients’ progression can be determined. This is a prime example that just by having the gene express gives it meaning. The mutant gene replicates expressing will cause a quickening progression of the disease, thereby proving that it does matter about concentration as well as meaning being truly associated with the expression of said gene.
  • As for codons, where as not every word can make sentences, every codon will make an amino acid or terminate the protein being expressed. As for the folding or function of those proteins, that matters not, what does matter is that by building the protein the biochemicals available are reduced thereby changing the concentration of reactants which has an impact on the biochemical reactions of the cell, Le'chatelier's principle is critical for driving biochemical reactions. (If you wish for me to explain this concept further I shall.) This once again shows the importance of concentration as well as how the gene has meaning based on if it is expressed or not.
  • You are incorrect about Down syndrome; it is a duplication of a chromosome, not a complete duplication of the genes on the chromosome. I am unsure how you could claim this is not new information since what is added to the equation is not an increase of what is there but the addition of something different providing a different outcome. I do agree that duplicating existing information will not turn bacteria into butterflies, since we also have an issue of bacteria not having mitochondria and the need for symbiosis is a little more complex than genetics, but duplicating and mutating will give us butterflies.
  • What exactly are you defining as new information?
  • Life spans are very important. They are small steps to something else, consider humans. With our longer lifespan we are able to live past our reproductive ages and continue to provide to our families. Beyond that the older a human female is at the time of conception the more mutations occur in the offspring. So longevity can lead to accelerated mutation which can lead to change. You are correct about the car and airplane however that is based on the assumption that there will be no changes to the parts of the car over time. I know for a fact that the 15 year old car I own has had many parts replaced and many of them are better than the original car parts, thereby not making the car I own now being the same as the car I first bought.
  • Beetle’s and wind. You see a defect where most see an adaptation. Evolution does not have a defined endpoint only that through mutation and selection is an organism evolved. Therefore the beetle that has the “defect” is the one the lives to spread its genes is better adapted to the environment. You say it is a loss of information but perhaps you may wish to see it as a change in information since the gene is still there, perhaps serving some other function. As for sickle-cell consider the following: The parents, of the offspring that is currently heterozygous (who receives the benefit of the mutation without the drawback), are both homozygous therefore Mom is AA and Dad is SS. The child is AS, this is not an increase in information? You have claimed many times before that a change in concentration (quantity) is not a change in information however this example shows that we go from an A to and AS as well as an S to and AS, seems to be an increase by your previous claim of an increase. Last time I checked 1+1=2.
  • New Information. You are right in regarding new information. If you bought the book about trains twice you would have the same information relating to the train information, however due to the cell being based on a series of systems you should consider this in your analogy: Your bank account has a new piece of information, the withdraw of additional funds for the second train book. This, as explained above, also happens in the cell. A replication of the same information changes the systems downstream depending on how it is expressed.
  • Race genetics. I love this, Philip seriously; do you believe your genome resembles more that of an Asian male compared to an Englishman? (I could understand this if you had some ancestry that came from Asia) You are not comparing items of the same magnitude, thereby taking the argument out of a logical progression. Of course the net changes between the races are less than what you see within a single race, since most of the change you see within a single race you happen to see among the other races. This is comparing apples to oranges. You find webbed fingers in Caucasians and in Africans, you find epicanthic folds in Asians as well as some Native Americans however you do not find more dramatic differences than what you find between the races, and I am not just talking about skin color. Nilotic is a term shared not only as a reference for language but also for a group of people in the Sudan that are the tallest humans, thus the reasoning between the Pygmy’s and the Nilotic, I was pointing out height. With that being said, are you saying there was a decrease in information to cause both the really tall Nilotic peoples and the really short pygmies when compared to Noah’s family?
  • Red Hair. I love this topic more than the others. The references you gave provided no information about the genetic origins of red hair, nor do they say anything more than Goddidit. What qualification does a vet. have compared to actual scientists who have spent almost their entire lives working on this area of genetics? Let us start by showing the fundamental problem with the article. Red hair is not caused by a mutation, nor is it because by the mutation of the gene that controls it. Eumelanin controls shade based on concentration while pheomelanin produces a red tint when it is expressed. The red hair is controlled by a lack of eumelanin in the hair and the production of pheomelanin. A lack of pheomelanin and a reduction of Eumelanin gives you the platinum blond color. The article is incorrect due to its assumption that it is a mutation that gives you red hair when in fact it is based on concentration of protein expressed and if the gene for pheomelanin is expressed. If anything the example of red hair, if taking the article seriously, shows an addition of information to the genome is required to produce the red in the hair since just by reducing the eumelanin would turn the hair blond, not red. On to your statement, it can be selected against due to the nature of homo vs. heterozygote; however you have to keep in mind that the carriers of red genes are found in every culture that you find brown hair peoples. The reason why it is decreasing is due to the probability of the red gene being expressed in conjunction with a decrease in the expression of eumelanin. At this level, meaning population genetic dispersion, you can use a basic punnett square can be used to show the probability of a red appearing based on a set of parents based on gene expression. It really is as simple as that.

--Timsh 17:32, 24 April 2009 (UTC)

I agree that mutations have an effect. But that's like saying that a construction manual that has an illegible sentence has "meaning" because it affects the construction. Rather, it affects the construction because it has lost meaning.
Duplicating and mutating will give us butterflies? From bacteria? Is this some observed phenomena, or evolutionary story-telling?
New information is the addition of (in this context) instructions that didn't exist before. A change from "produce four legs" to "produce five legs" is not new information. A change from "produce four legs" to "produce four legs and produce two antenna" is adding new information.
Evolution doesn't (just) propose that a starfish can turn into a better starfish; it proposes that a fish can (over time) grow legs, breath air, and walk around on land. That's not the equivalent of an improved car, but the equivalent of a car turning into an aeroplane, which you acknowledge wouldn't happen.
Regarding the beetles, I accept that evolutionists would call the loss of wings "evolution". But evolution will never turn a bacteria into a biologists by losing functionality. So the wingless beetle is not an example of the sort of thing that molecules-to-man evolution requires. With the sickle-cell genes, you are still ignoring the meaning of the genetic information, and simply equating "change" with "information". I should explain that more, but I've covered it in other discussions.
The analogy of the funds for the train book is covered, I believe, by my first paragraph.
As far as my genome goes, it depends on whether you are talking about my genome, or a typical English genome. My point was that my genome would more closely resemble some Asian genomes than some English genomes, because the differences within a "race" are greater than the differences between "races".
As far as Nilotic people are concerned, my comment was based on this from Wikipedia, which, incidentally, doesn't mention their height at all:

Nilotic people ... refers to some ethnic groups mainly in southern Sudan, Uganda, Kenya, and northern Tanzania, who speak Nilotic languages ... The terms Nilotic and Nilote were previously used as racial classifications, based on now widely discarded perceptions. These terms are now foremost used to distinguish "Nilotic people" from their ethnic neighbours ... based on ethnolinguistic affiliation.

Yes, a decrease in information could well be the cause of the height differences in both pygmies and Nilotic peoples. See genetic information#Differentiation and speciation for how this could be so.
The articles I linked to provided no information about the genetic origins of red hair? Funny, I thought that's exactly what they did. And no, they don't say "goddidit" at all. On the contrary, they say that mutations did it. Are you sure you were reading and not imagining what they said? A vet? So (a) you attack the qualifications of one of the authors rather than what they are saying (a logical fallacy), and (b) you ignore that the second, more technical, article was by a biologist. Red hair is not caused by a mutation...: Oh, so you did read the articles! Then if you are acknowledging that the articles claim that a mutation is responsible, why did you earlier claim that the articles attributed it to God? You can't have it both ways. Your explanation of red hair is one of describing how the chemicals produce red hair, and in no way contradicts the articles describing how this probably originated. Your attempted response to my question about red hair being eliminated gives a plausible-sounding reason why it would be getting eliminated, but fails to answer my question of how it came to be as widespread as it is if this is the case.
Philip J. Raymentdiscuss 15:53, 25 April 2009 (UTC)


Keep in mind that I am currently reading through the sources you provided on one of your last postings and I am currently writing a summery of each one for review.
Your first point about construction, you are placing your POV on a biochemical process. There is no such thing as an illegible sentence when it comes to genetic code, it affects the chemicals around it. As I stated before meaning is rather the gene was expressed or not, applying more would be taking the gene out of the context of the processes that it immediately affects.
The duplicating and mutating is inference, you can use your sentence example to support this. “A king plays his pipes.” can equal “Evolution is based on the progressive mutation in conjunction with natural selection to cause a phenotypical change in an organism.” With enough mutations and duplications.
Vpu vs Vpr in HIV. You wanted an example before well here it is. Vpr codes for
Starfish, evolution proposes that what you stated could happen over time in conjunction with natural selection. I acknowledge that the car would not turn into a plane under normal circumstances, however I know of many situations where a car has been changed into a plane by human hands, just like when I replace the parts on my car to make it perform better. Under normal circumstances an organism will stay the same however mutation along with natural selection will change it. Even creationists agree with this, the disagreement is based on how far the changes will go. Evolutionists say that it can lead to far different organisms while creationists believe it is only within the kinds.
Philip, meaning has nothing to do with the sickle-cell item. What possible meaning are you looking for? You have two different alleles; they combine in the offspring providing a different response in the offspring than what was in the parent. It shows an addition of information from a mutation that gives a beneficial trait to the offspring. Your questioning of meaning has no relevance here.
I will read back about the funds for the train book, your response still does not address my comment.
Your genome, I added the caveat that if you had Asian ancestors your statement may be correct if not then your comment fails. If we are looking at comparing you to a typical English and a Chinese male you would be closer to the English than the Chinese hands down. You point out some, yes there could be some cross cultures that would allow for this but there are outliers everywhere. We are basing it on origins of ancestors.
No problem about the Nilotic peoples. I should have been less ambiguous.
Red Hair. The articles you linked did not provide genetic origins of red hair. The first article, written by a vet, provided in correct information regarding the basic genetics of red hair and then concluded that red hair was a mutation. The problem with this is two fold, if the stance is that red hair is a mutation then red hair is new information due to the protein that is coded by the gene that causes red hair also does a number of other functions. The second problem is that red hair has been found in Neolithic remains, so according to the claim that red hair would have been a mutation introduced at the fall due to a decrease of information would mean that the dispersion of the gene would have been far lessened right after Noah, even if they were carriers (which by the way, Jewish ancestry do not carry the gene). So to conclude the article is either wrong in respect to the new information piece (since it would contradict due to timescale as well as dispersion) or the writer of the article is not a person aware enough of genetics to be making claims (she is a vetinarian, not a geneticist). The second article was about zebra fish and skin color. I read the actual published paper about the relationship and it seems to me that Creation.com failed to understand two distinct points. The first is that the protein from the fish can be used by humans; the second is the human analog protein can not be used by the fish. This happens often in molecular biology were the proteins found in less evolved organisms or related organisms have no problem functioning in the higher organism, however the proteins in the high organism doe not function well or at all in lower organisms. In fact one method of tracing relationship of organisms is to check the proteins for homogenality. The more closely the proteins match the closer the organisms are related. Now to the point. The paper fails to address the origins of red hair, it speculates mostly and pokes at the zebra fish paper concluding without understanding what I described previously. This is the problem, the people who are writing these papers are writing outside of the fields where they were not informed of the area completely enough to make these statements. It is not the fault of the education system since it takes years to be exposed to all of this information. The problem is that these people making these claims make them as if they were experts in their fields, such as stating the teaching record and other awards but not showing why the are capable of making these claims in these fields.
To anwser your question of red hair being widespread, it was first, the mutation is the lack of red color. It has been found across Europe in remains of prehistoric people and it was further spread due to the exploration nature of Europe. Quiet logical if you think about it, a high density of the gene is spread within the general population. Since the gene has a 1 and four chance of showing red then that is pretty high compared to some other chances of genetic expression, not to mention the homozygous carriers of the gene.--Timsh 11:28, 26 April 2009 (UTC)
Your claim about there being no such thing as an illegible sentence appears to assume that any values (letters/codons) will produce something meaningful, rather than junk. That is the point of "meaning"; whether it produces something meaningful, as opposed to junk.
I don't follow your sentence beginning with "The duplicating and mutating...". One sentence can only mean an entirely different sentence by changing the meaning (there's that word again) of the words.
Yes, you could convert a car into an aeroplane "by human hands" (read: via intelligent design), but only because you have an ultimate goal to work to, and not by random changes with each change still having a viable vehicle/creature.
Under normal circumstances an organism will stay the same however mutation along with natural selection will change it. Even creationists agree with this, the disagreement is based on how far the changes will go.: Incorrect. The disagreement is not with the amount of change, but the direction of change[13].
...meaning has nothing to do with the sickle-cell item.: The original, un-mutated, cell was meaningless? It just produced junk?
On Asian vs. English, I'll try it with a diagram.
Legend:
  • P = me
  • e and E = Englishmen
  • A and a = Asians.
  • | = average for each group.
The spread of letters shows the range of genetic difference. The diagram is conceptual only.
 eeeeeeeeeEeeeeeeeeeePe|eeeeeeeeeeeeeeeeeeeeee
          aaaaaaaaaaaaaaaaAaaaaa|aaaaaaaaaaaaaaaaaaaaaa
In this diagram...
  • The range of Englishmen, like the range of Asians, is greater than the difference between the two.
  • I'm closer to A than I am to E. This is consistent with my previous comment that 'My point was that my genome would more closely resemble some Asian genomes than some English genomes, because the differences within a "race" are greater than the differences between "races".'
We are basing it on origins of ancestors.: Noah's descendants?
The first article, written by a vet, provided in correct information regarding the basic genetics of red hair...: What, specifically, was incorrect about it.
...the claim that red hair would have been a mutation introduced at the fall due to a decrease of information would mean that the dispersion of the gene would have been far lessened right after Noah...: You misread it. The article didn't say at the Fall, but since the Fall. And it didn't say how much since; it could well have been (probably was) post-Flood. (And although it doesn't change your point, Noah and his family were not just the ancestors of the Jews, but of us all.) It seems that the rest of your rebuttal of the first article relied on this misreading.
...Creation.com failed to understand two distinct points. The first is that the protein from the fish can be used by humans; the second is the human analog protein can not be used by the fish.: I can't see the relevance of this to red hair, other than the comment in the article that "The human and zebrafish genes are so similar in function that the human gene (allele G) activated normal melanin production in zebrafish that have the mutant gene (golden).", which doesn't sound like a "failure to understand" so much as an outright contradiction, and as you're not alleging that, I've no idea what you're getting at here.
The paper fails to address the origins of red hair.... "They have probably inherited a defective gene which makes their pigment cells ‘unable to respond to normal signals that stimulate eumelanin production’" seems to me to be implying that the origin is a defect (mutation).
This is the problem, the people who are writing these papers are writing outside of the fields... And yet you've still not actually demonstrated any error on their parts!
Your answer regarding the spread of red hair still doesn't make much sense to me. Your only answer for it's spread seems to be because of the spread of Europeans around the world. That would explain a geographical spread, but not how the gene spread within the population if it's being selected against. If you were saying that it's selected for within Europeans, and thus spread whilst they were isolated, but is now being selected against because of more genetic mixing from non-Europeans, that might make some sort of sense, but you've not said that so far and I don't think you're saying that even now.
Philip J. Raymentdiscuss 12:14, 27 April 2009 (UTC)

Increased information

italian wall lizards, unbreakable bones, anti-freeze proteins, nylonase...
how about we stop giving you examples of increased information through mutation and you give us a definition of information.
and no, not "I've already defined this elsewhere". Link to it. Or define it here. Or define it in information. Stop running from the truth, Phillip. It is so obviously, demonstrably clear that mutation can increase information that I don't know if you're lying to me, yourself, or both. Neveruse513 14:34, 15 April 2009 (UTC)
I am not entering into this discussion, but could you, Neveruse513, tell more about Italian wall lizards? The fact is that I live in Italy and there are plenty of cute lizards in my garden! I'd like to know if there is something interesting or controversial about them that I don't know. Thank you, --Catholic 16:22, 15 April 2009 (UTC)
Information is data that has meaning. A simple explanation is at cp:information, a more detailed one here, and a full-blown book available from a link here. Se also genetic information. It's only "obviously, demonstrably clear that mutation can increase information" if you believe that almost any mutation is an increase of information. And if it's so clear, why was Richard Dawkins unable to offer any examples when asked? (See cw:Dawkins could not give an example of increasing information (Talk.Origins)). Philip J. Raymentdiscuss 03:08, 16 April 2009 (UTC)
I'm confused. You posit that
  • It's only "obviously, demonstrably clear that mutation can increase information" if you believe that almost any mutation is an increase of information. (bold emphasis added).
But I don't understand. I would think:
  • It's "obviously, demonstrably clear that mutation can increase information" if you believe that there exist some mutations that are an increase of information.
If mutations can increase information, they can increase information, can't they? HermanH 13:37, 22 April 2009 (UTC)


What your sources fail to address is the context of the meaning of chemical information. I believe I pointed out above. As for Dawkins, his field is truly not on biochemistry, perhaps his understanding goes as far as molecular genetics but the question of information is one that should have been asked of a biochemist. I do not know of any scientist who would claim to have a complete understanding of evolution to be able to debate it from all angles. Dawkins does very well for most that he is asked but he is a biologist afterall, not a chemist and when it comes to chemical information it should be a chemist that is asked.--Timsh 17:48, 16 April 2009 (UTC)

My sources failed to address what specifically? They certainly talked about the meaning of biochemical information.
Dawkins didn't exactly say "I'm sorry, that's out of my field of expertise". In any case, the information content of the genome and how it came to be is (needs to be) absolutely crucial to understanding evolution. Without increasing information, evolution simply could not occur. So it's the sort of thing that any evolutionist worth his salt should know about, even if it's not something he's personally studied in the lab. But to take your point about who to ask, Lee Spetner is a biophysicist and information theorist, and he said that "All point mutations that have been studied on the molecular level turn out to reduce the genetic information and not to increase it. ... Not even one mutation has been observed that adds a little information to the genome"[14]. Or if you want it from a chemist, see here.
Philip J. Raymentdiscuss 13:25, 22 April 2009 (UTC)

To Be completely Fair...

Given the mission statement of the site, it seems reasonable that throwing in much doubt about the veracity of the story is folly. I am not stating that this article shouldn't be as correct as it can possibly be made, but I think the focus should be limited and deferred to aSK's perspective in this case.

The only thing I will say, however -insofar as there is still one thing that irks me about the great flood- is that rain for 40 days and 40 nights, falling all over the globe, in a quantity sufficient to cover even the highest mountain top, would kill anything that needed airborne oxygen to breath. The amount of water vapor that would have saturated the atmosphere would have not only blotted out the sun and lead to the death of all the plankton in the ocean, but would have caused such a terrible ecological catastrophe you would have to be a divine being to survive it. Just my 2 cents. Jirby 06:55, 30 March 2009 (UTC)

Please read what the Bible actually says, as well as creationists' explanations of it. The Bible does not attribute the flood solely (or even primarily) to rain. Philip J. Raymentdiscuss 09:20, 30 March 2009 (UTC)
hmm, yes, I ought have specified a tad more I think. From what I remember of the account, water cracked through the continents and caused a lot of flooding that way too, but even still, that much water vapor - water turnover, would have been ecologically devastating... well, more aptly annihilating. Now, it's possible God rewarded Noah by renewing all the plant life once the water dried up, but even then, that seems to be invoking a miracle were there would not be one. Jirby 09:29, 30 March 2009 (UTC)
How much water vapour? Your argument seemed to presume that the flood was entirely caused by the rain (which would give some indication of the quantity), but we now agree that's incorrect, and that it was all up there to start with, instead of, say, being evaporated (in some places) simultaneously with falling (in other places). So how much water vapour was there? Philip J. Raymentdiscuss 12:18, 30 March 2009 (UTC)
Yes, well I need to stop writing at 5 AM when I ought be finishing school work, so I apologize for my miscommunications. That being the case, unless I am more ignorant than I had otherwise concluded, rain fell for 40 days and 40 nights, as well as shooting up from fissures within the Earth. As it is pertinent to water vapor in the atmosphere, the kind of deluge that the Bible describes would be sufficient enough to drown anything that needed airborne oxygen to survive. Even if most of the water did not fall from the skies, but instead surged from the bowels of the Earth, you still have the problem of a lot of that water ending up in the atmosphere, and not even due to evaporation. Ever been on a body of water that was even slightly disturbed? All that movement causes a lot of water to be hucked into the air above it, on a global scale such as with the flood it follows that all of this chaos would cause the air immediately above the water's surface to be completely saturated beyond reason.
Though, even if it was not the case that it would have ended up in the atmosphere (due to a nuance of the story I am missing, or that was omitted from the original account, or because God intervened on their behalf, ect.), the worlds ecology would be no less ravaged. Water from the crust would cause world wide ocean turnovers, basically degassing the entire world's water supply. Everything above the water would be gassed to death, basically, and everything living in the water (if not dead due to the stress of water violently moving) would have to try and survive this explosive release / remixing of gasses. Though again, this could all be based on a misconception of the account on my part, so I defer to your knowledge in the area.Jirby 20:31, 30 March 2009 (UTC)
That's mostly just sweeping statements that are hard to give a specific reply to. Of course the purpose of the flood was, in effect so that "the worlds ecology would be no less ravaged". Philip J. Raymentdiscuss 05:53, 31 March 2009 (UTC)
And that would be a major problem. You can't take part of a system, destroy the part you left, and then put the part you excised back and expect the system to work again. Zebra, lions, tarantulas, apes, people, cuddlefish, you name it, all exist because they are supported by the pertinent ecology; destroy it all and what happens? Starvation. Now the reason why my arguments are important is that you only have this disastrous scenario if you in any way endorse a world wide flood. You would not get the benefit of vegetation mats, or of areas where the water was mostly fresh so the fish could survive, or of a convenient place for the emission of heated gasses to go so everything above water wasn't suffocated / chemically burned to death. Now yes, God being the keeper of creation, could have made all of those things arbitrarily possible for the benefit of Noah. Do we then have any reason to necessarily believe that? It is not mentioned in scripture, no "And he reseedeth the Earth..." or any such passage. No, Noah got a rainbow and that was about all that was said about God's relationship to the post Flood Earth. You may still believe it true within the context of the faith, but then it will only read as a story or a fable, and there would not be any scientific skepticism on the subject. Jirby 17:07, 7 April 2009 (UTC)
Although this post of yours is a little more specific, it's still not very helpful. But I'll address what points I can.
No, I don't know of any reason to invoke Divine intervention in the ecological restoration after the flood. But you overlook the possibility (as claimed by creationists) that God would have designed creatures with plenty of adaptability, and that the greater specificity (of diet, saline concentration, etc.) that we observe today is something that has arisen by increasing specialisation by creatures since the flood.
Philip J. Raymentdiscuss 12:04, 8 April 2009 (UTC)


In the earlier discussion on bird-flu, you claimed (in your comment 05:50, 31 March 2009 (UTC)):

  • "Something less specific has less information. The virus was specific to birds, but it is now less specific, and can affect humans also."

Logically, then, something more specific has more information, yes?
Now in this discussion you claim:

  • "...that the greater specificity (of diet, saline concentration, etc.) that we observe today is something that has arisen by increasing specialisation by creatures since the flood." (emphasis added).

Which would thus mean an increase in information in those creatures since the flood? HermanH 13:17, 8 April 2009 (UTC)

Good pickup! Occasionally you blokes do come up with a reasonable question! :-)
I've e-mailed someone to find the answer to that. I'll reply once I get the answer back.
In the meantime, genetic information and this article might provide some background at least.
Philip J. Raymentdiscuss 14:40, 15 April 2009 (UTC)
My AUD0.02
“Specific” has meaning both for description, and for applicability/suitability. The term seems to be used in more than one way in this discussion, and I think that has contributed to some confusion. “Something less specific has less information” looks to be referring to the descriptive usage (as in “Something that can be described less specifically”). The “greater specificity that we observe” seems to be the usage of suitability. In that example (more specific food/salinity requirements), the increased specialisation is a result of a reduced specificity in the local genome. This is because not every salmon (for example) has all the information in the salmon genome. The population has a variety of specifications; in other words a descriptive algorithm would need a great deal of specificity to describe “salmon”, as it has to cover all the alternate specifications present in the genome of the population (for instance, many ranges of salinity tolerance). If salmon as a population could tolerate a wide range of salinity (with ranges varying from individual to individual), and some portions of that population found themselves in high salinity water, then the individuals that can not tolerate high salinity die, and their specificity is lost from the genome Likewise, populations finding themselves low-salinity water would lose the individuals requiring higher salinity, thus losing their specificity. So in both cases the salmon become more specialised (more specific suitability), by losing specificity (this is the information part) from their genome. There are those that have a tolerance range covering both fresh water and sea water and these would be able to migrate between the two environments. So instead of just salmon, we also have brook trout and ocean trout. To see the decrease in information, fully describe a brook trout, then fully describe an ocean trout, then fully describe a salmon. Finally fully describe a generic salmonidae that may be freshwater, saltwater, or migratory. The last description must encompass all of the previous three (at least), and therefore needs more information. In other words, the more specialised salmonidae can be described with less information.BradleyF (LowKey) 02:33, 16 April 2009 (UTC)
Re:Philip: I will await the answer you've mailed for, and will also look into the links provided, thanks! HermanH 18:29, 20 April 2009 (UTC)
Re:Bradley: I don't think this is the case, as I read it. In both instances, the specificity is referring to environments in which an organism can survive. In the bird-flu example, the very next line by Philip is "The virus was specific to birds, but it is now less specific, and can affect humans also." So this is clearly referring to the virus going from a more specific environment (only birds) to a less specific environment (birds and humans). Just as your example about salmon the fish is going from a less specific environment (salt and sweet water) to a more specific one (only salt water, or only sweet water). HermanH 18:29, 20 April 2009 (UTC)
HermanH, you only picked up on one instance. The instance you refer to is indeed going from a more specific environment to a less specific one, but the other instance was actually as per my example (less specific environment => more specific environment) and in fact is what I based my example on. That "movements" both ways can be due to loss is aconcept that gives evolutions great difficulty and not a little frustration. It leads to claims of intellectual dishonesty and rhetoric along the lines of, "How can it be downhill that way and then downhill again this way?". There are actually three genetic "mechanisms" that natural selection works on, and these account for the two so-called "directions" that are still downhill. Firstly (and much more commonly) there is the natural pre-existing genetic variation within the genome. Changes in the environment select for some variants and against others, resulting in a loss of some variants; a thinning out of the genome - a loss. Then there is the ability of viri (and I think bacteria) to exchange portions of their genome. So there is an organism with a new code to be selected for or against. This is really neither a gain nor a loss because the there is nothing new involved (if I pull the wheels off a Lego car and attach them to some other Lego model, wheels are not new to Lego). Thirdly there are mutations, which may be beneficial, but have never yet been shown to increase the information content of the genome. Mutations are demonstrably also "downhill" or "lossy", which has been discussed ad nauseum already. The point is that sometimes it is an environmental change that brings natural selection into play, and other times it is a genetic change. These aren't two "directions" so much as two causes. I also eagerly await the email response :^D BradleyF (LowKey) 02:09, 21 April 2009 (UTC)
I thought I did in fact handle both instances (bird-flu and salmon) and showed why I thought they were contradictory. You have now introduced a new mechanism to explain this, which is interesting. Specifically, I am referring to what you said here: "Then there is the ability of viri (and I think bacteria) to exchange portions of their genome. So there is an organism with a new code to be selected for or against. This is really neither a gain nor a loss because the there is nothing new involved (if I pull the wheels off a Lego car and attach them to some other Lego model, wheels are not new to Lego)." If I understand this correctly, this is a claim that an organism can have a local increase of information, but that this does not represent true increase, because it is not a global increase of information? As per your example, the lego wheels may be new information to the local system (the other lego model we put them on), but are not new to the global system (lego as a whole). Correct? This is also similar to the "dog example" on the genetic information page. Where, if an LL father and an SS mother have LS offspring, the offspring has more information than either parent on their own, but not more information than the parents have together. The local system here being a specific dog, with the global system being the entire pack of dogs (or species, for that matter). HermanH 07:47, 21 April 2009 (UTC)
Yes, this is correct. To go from reptiles to birds, for example, you have to add the genetic instructions (information) for feathers. Where does this come from? In theory, it could come from some other creature that has the genetic instructions for feathers. But that only removes the problem another step. Where did those other creatures get the information for feathers? So although a transfer of genes from organism to another does occur and can explain some situations, it doesn't solve the problem of where the information came from in the first place. Philip J. Raymentdiscuss 13:48, 22 April 2009 (UTC)

(unindent) I have read the genetic information article and have commented there. The example given there is pretty similar to the one BradleyF gives above, with an initial population splitting into subgroups that have lost information in adapting to a more specific environments. So I will not discuss that here any further.

I have also read the other article given, which is a very interesting article and finally gives some idea of how information, and genetic information, are defined. It defines information content in five levels (statistics, syntax, semantics, pragmatics and apobetics), and defines information as that which has (at least) semantics (Gitt's theorem 9). It is useful in discussing an actual genetic example, as well as a language example. For the genetic code given, it views the statistics level as the individual characters (ACGT), the syntax level as the triplets (TCT, AAG, etc), the semantics level as the amino acids they encode for, the pragmatics level as the genes (the discussed genetic sequences are not recognized by the author) and the apobetics level as the "outcome" (ie: what the purpose of the gene is). With the language example ("She has a yellow vehicle", "She has a yellow car"), they show that a reduction in information content at the statistics level (the sentence becomes shorter) can lead to an increase in information content at the apobetics level (Here they refer to "specificity" as being one measure of information content, related to the "purpose" of the information, where "purpose" has been defined as being on the apobetics level). Presumably, this shows that shortening a genetic code (reduction at the statistics level) can lead to an increase in information (at the apobetics, or purpose, level). Since "deletion" is one of the "copying errors" that happens in genetics, this would mean that the article supports the idea that evolutionary processes can lead to an increase in information. HermanH 09:01, 22 April 2009 (UTC)

Yes, deletion is one of the copying errors. As is duplication. But that ignores the question of what the effect is on meaning. To stick with the example, "car" is shorter than "vehicle", but how do you go from "vehicle" to "car" simply by deletion? To go straight to the punchline, you go from "vehicle" to "car" by means of intelligent input, not by random changes. The same applies with genetic information: random changes don't generate information. Philip J. Raymentdiscuss 13:48, 22 April 2009 (UTC)
Ok, slightly different example: "She has a colored car", "She has a red car". By only deleting "colo" we get a more specific sentence. All I am claiming is that some random changes can lead to new information. And your claim that "random mutations can never lead to new information" can be disproved by a single counter-example, can it not? HermanH 14:07, 22 April 2009 (UTC)
I have mentioned (elsewhere? The comment about this discussion being all over the place is correct) that there might be the very rare examples of an increase in information caused by mutations. And indeed I would consider this a valid example of how that might happen. (I also said that it's tedious to point out this rare exception to the rule every time I mention the rule.)
However, your change was not random, of course. No, I'm not saying that it couldn't happen randomly. I'm saying that the likelihood of this particular change occurring randomly is vanishingly small. Your original sentence had 17 letters. Let's keep this simple and ignore spaces and case. There are 425 (17x25) possible one-letter changes that could be made (excluding "changes" that are not changes, such as substituting "a" for the second-last letter). There are 170,000 (17x25 x 16x25) possible two-letter changes that could be made. There are 63,750,000 (17x25 x 16x25 x 15x25) possible three-letter changes that could be made. That's 63,920,425 possible one, two, or three-letter changes that could be made to that sentence. And even that's too low, because I haven't allowed for deletions (per your example) and insertions. So out of (say), about 64 million possible changes, you've come up with one that is an increase in information. Of course this figure depends on a number of variables, and will vary from circumstance to circumstance. DNA does not have 25 possible changes per letter: it only has three. But I believe that the sequences that you would be changing would normally be a lot longer than 17 characters. Of course, there may be more than one possible increase-from-change with that sentence. You might come up with two or three. But three out of about 64 million is still an awfully long shot. And of course you designed that sentence to be changeable in this way. A lot of sentences would not be so amenable.
See more under "A test" below.
Philip J. Raymentdiscuss 12:14, 23 April 2009 (UTC)
Although the statistics you give are off a little (you fail to account for duplicates), the general gist that information increasing mutations are rare is fully correct. But as I've said, my claim has always been that they are possible, not that they are likely. Correct me if I'm wrong, but any example of random mutation increasing information disproves the theory that such a thing can never happen. And thereby disproves that information can only come from an intelligent source. Or am I missing something? HermanH 14:09, 23 April 2009 (UTC)
My statistics could well be off, although I don't know what you are referring to that I didn't mention (I did mention insertions, which a duplication would be). At the start of that reply of mine that you are replying to I answer your point about unlikely vs. possible. Going (back to) the tyre example that I discussed somewhere, there is an extremely small chance that a random change is going to result in a better tyre. But there's no chance that a random change—even a series of them—will "evolve" that care into an aeroplane. The sort of information required for that is impossible without an intelligence. I'll explain more on this tomorrow. Philip J. Raymentdiscuss 15:10, 23 April 2009 (UTC)
You can't give Phillip an example of an increase in information if he doesn't define what he believes is an increase in information.
Phillip, I suggest you give an example of an increase in information using the simplest information system we have: binary. Show me, with binary examples, what an increase in information is. Or is is impossible to increase information represented by binary? Neveruse513 14:29, 22 April 2009 (UTC)
HermanH was able to understand it.
Binary's fine. The issue is what it means. See [15].
Philip J. Raymentdiscuss 12:14, 23 April 2009 (UTC)
Please, Phillip. Pretty please. Show me an example of an increase in information using binary. Please. Neveruse513 13:06, 23 April 2009 (UTC)
Did you read the link? You could also read information. Philip J. Raymentdiscuss 13:38, 23 April 2009 (UTC)
I just want it to be clear that you are unwilling or unable to produce an example of an increase in information. Phillip: Can you give me an example (and not send me down some creationist rabbit hole with links)? Neveruse513 14:01, 23 April 2009 (UTC)
Are you beginning to see the problem of saying that there have been no increases in information when you can't even offer a single example of what an increase in information would be? Neveruse513 14:09, 23 April 2009 (UTC)
As you are making the positive claim (that there have been information increases) isn't the onus upon you to a/ define it, and b/ provide some argumentation? I am of course referring to your own assertions about the burden belonging to the positive claim. I am getting a little frustrated that you keep demanding something, keep getting it, and keep insisting you haven't (or change the demand to something else). If you want to discuss, discuss. If you want to debate, debate. But what you are doing is not even simple contradiction so much as head-in-the-sand wilfull ignorance, apparently to score points of some sort (e.g. your "I just want it to be clear that you are unwilling or unable..." above). Put another way; your signal to noise ratio is quite low. Put yet another; you are not doing much to increase information. BradleyF (LowKey) 00:43, 24 April 2009 (UTC)
You're right about that, Bradley, but Phillip will not accept our definitions (or this would have been really easy. As such, the onus is on him to provide a definition that meets his claims (or fails to meet ours). Neveruse513 21:23, 24 April 2009 (UTC)
No, I'm not unwilling nor unable. I just figured that if you read and understood that article, you'd figure it out for yourself. But of course when you have such a closed mind that you refer to an exlanatory article as a "rabbit hole", you shouldn't expect to get far. It's past time I was headed to bed, so I won't do the binary version, but this should be enough to illustrate for you, if you're not being deliberately difficult.
  1. Place the cake into the oven.
  2. Place the cake into the oven and cook for 30 minutes.
Sentence two has an increas in information over sentence one. It tells you more than the first sentence. If you want it in binary, convert those sentences to the binary values for the ASCII values of those characters.
Philip J. Raymentdiscuss 15:17, 23 April 2009 (UTC)
Phillip, are you unwilling or unable to proffer a binary example??? Neveruse513 21:21, 24 April 2009 (UTC)
Didn't you read the comment that you replied to? Philip J. Raymentdiscuss 01:49, 25 April 2009 (UTC)
Actually, you could even use unary if you wanted to, but I think it would be fantastically more difficult to arrive at your assertion. Neveruse513 15:26, 22 April 2009 (UTC)
I've been following this for some time and I thought HermanH's example was quite interesting. I was thinking about it a little farther. How about - "She has a colored car", "She has a red car", "She has a red cap". Doesn't this mutate from the initial statement to something more specific and then to something completely new while still having less information (four less letters) than the initial? -- Edgerunner76 15:00, 22 April 2009 (UTC)
I don't really understand any of this. I thought DNA just reacted with whatever it reacted with - why does information have to come into it? It's a vastly simpler reaction, but if I throw some potassium into some acid I don't say it contains information, I just get a lot of fizz.--CPalmer 15:36, 22 April 2009 (UTC)
Because DNA is a code, just like a language. Philip J. Raymentdiscuss 12:14, 23 April 2009 (UTC)
We're discussing the problem of information/complexity arising through evolutionary means. This is an epic stumbling block for understanding evolution. Neveruse513 16:37, 22 April 2009 (UTC)
I have to agree with CPalmer. I have tried to keep up with this, but very little of it makes sense. It seems to me that the question is - "what is the unit of measurement for information" - and there doesn't seem to be an answer.
On another note, shouldn't this be moved from Talk:Great Flood to Talk:Information? -- Edgerunner76 15:51, 22 April 2009 (UTC)
It's surprising how many pages come back around to this. Neveruse513 16:37, 22 April 2009 (UTC)
Why should you be surprised that the drum that you are consistently beating gets beaten consistently? BradleyF (LowKey) 02:57, 23 April 2009 (UTC)
"We" just want to know what "you" are talking about when you use the word. The beating of the drum is all here, where the word is used indiscriminately to argue against any form of evolution having ever occurred. Since it's a "sciency" sounding term, can you fault "us" for wanting a clear definition? ħuman Number 19 03:52, 23 April 2009 (UTC)
My dig was purely aimed at expressing surprise over one's own ongoing actions. There's something ever so slightly dissociative about that concept. I will say that Edge's comment about a unit of measure is about the most constructive thing coming from the "nae's" in a while. It certainly beats the constant "undefined" cry (in the face of definitions and links to definitions). I think it's a little bit of an oversimplification, but it is still a constructive comment and perhaps a step towards a more common understanding. I personally don't have a ready answer BTW, as most of the units of measure that come to mind would best be described as applying to data rather than information. I will look into it, but I expect others probably already know this without the need for additional research. (BTW, I am still looking into that "Federal Head" thing, but I keep finding usages of the term, rather than a decent definition) BradleyF (LowKey) 04:19, 23 April 2009 (UTC)

Philip, you do realize that once you talk about probabilities (or likelihoods) of letters in a string of information you are talking about Shannon information, don't you? Sterile 21:31, 23 April 2009 (UTC)

A test

HermanH designed his own phrase to "mutate" for a gain in information. Rather than a phrase that is designed for this, I'm going to offer a phrase which is designed to be harder.

trap big animal paws.

The challenge is to cause an increase in information in this sentence by substituting up to three letters, deleting up to three letters, or inserting up to three letters.

If you can't increase the information in it, then alter it in a way that still makes sense. But whatever you do, don't reduce the amount of information in it.

I'd like to see several have a go. Let's see how good the best result is.

Philip J. Raymentdiscuss 12:14, 23 April 2009 (UTC)

Can we use a combination of deletion, insertion and substitution? i.e. one deletion and 2 substitutions etc. ? Taytopacket 13:05, 23 April 2009 (UTC)
Yes. Philip J. Raymentdiscuss 13:35, 23 April 2009 (UTC)
I don't know what qualifies as an increase of information on ASK, but I like games, so how about I wrap bit animal paws as in a vet? One insertion, two substitutions. Neveruse513 13:41, 23 April 2009 (UTC)

Ok, sure, here's some:

  • trap pig animal paws - instead of the generic "big animal" we now have the more specific "pig animal".
  • I trap big animal paws - We have added the information on which person is performing the action (could also be "we trap" to add the infromation that there are mutliple people involved, or "he traps" to add gender)
  • trap my big animal paws - By indicating the owner of the animal, it becomes more specific (again, this could also be "our" for indicating shared ownership or "his"/"her" adding the gender of the owner).

But other than an interesting challenge, this is really beside the point of the discussion. My point was, and has always been, that random changes can cause an increase of information. I have never claimed this to be likely, just possible. HermanH 13:49, 23 April 2009 (UTC)

I actually wrote something about this on RW a long time ago. It's quite interesting. By stating that something is impossible, you open yourself to ridicule. The strategy is to make something seem to be so unlikely that the average person begins to equate it with impossibility without that overt statement. The idea is to stick with - extremely/very/immensely unlikely - while never mentioning that, by definition, means possible. -- Edgerunner76 14:27, 23 April 2009 (UTC)
For the 1000th time, word analogies are horrible to apply to genetics. The filter by which we interpret language is very different than the processes by which life develops. Words are not genes, and letter frequencies are not codon frequencies. And none of you have defined what is more information. Sterile 14:46, 23 April 2009 (UTC)
How about trap BIG animal paws? By substituting three caps, you are providing extra information about how big the paws are: they are seriously big.--CPalmer 15:39, 23 April 2009 (UTC)
Of course, the main problem is that you are assuming that random changes can't be made which DON'T help the creature. They can. So, over the course of several additions/substitions/removals, I could have I trap cat paws in a bear trap, which is very specific. As long as the mutation won't outright kill the animal, it still has a chance to improve the modification. --Acionyx 00:19, 24 April 2009 (UTC)
Very well. You have forced my hand. With this constant repetition of the word "information", and comparison of English sentences to the genetic code, you have given me no choice but to start a biology class.

To Sterile, no analogy is perfect, but an English language analogy, if not carried too far, is quite legitimate (and evolutionists debating with me have used exactly the same sorts of analogies). One fault of it is that English has upper and lower case letters, for which there is no analogy in DNA. So I'll disallow CPalmer's submission on those grounds.

Acionyx, I think you've tripped up on your double negative there. I assume no such thing.

Philip J. Raymentdiscuss 15:26, 24 April 2009 (UTC)

No Phil, English is a bad analogy because

  1. There are 52 possible letters, plus punctuation, meaning perhaps hundreds of characters
  2. There are hundreds of thousands of words possible.
  3. Most, if not all, mean diffrent things

Whereas in the genetic code

  1. Threr a four characters, A, G, T, C(5 if you count Uracil as seperate, which it is not)
  2. There are 64 combinations of letters, "words" if you must
  3. Even though there are 64 "words", they can only "mean" (code for) 20 things, meaning on average there are 3 words for every meaning
  4. Instead of having dozens of punctuation marks ($*(^#@<>,,..), there are a total of 2-AUG for start, and UAA, UGA, and UAG for stop.

While the "english" analogy is great for teaching someone what purpose the genetic code serves, and how it does that, it is a utter, even epic, failure in trying to represent mutations and evolution.

The EmperorRise, my apprentice 17:19, 24 April 2009 (UTC)

You've provided nothing but assertion that conflicts with what I said above. Yes, your facts are correct, but they don't conflict with what I said. Philip J. Raymentdiscuss 01:51, 25 April 2009 (UTC)

Test results

Okay a few took up my challenge. Let's see how you all went. But before I get on to that, I'll admit that I've realised that I didn't pass the test too well. I thought "gib" meant "jib". You'll see the problem with that error shortly.

First, I'd like to remind you all of a couple of points:

  • I said that "whatever you do, don't reduce the amount of information in it."
  • I said that my phrase "is designed to be harder".

One problem evolutionists (in particular) have is in expecting things (life, etc.) to be simpler than they really are. That's the point behind the title to Michael Behe's book, Darwin's Black Box: The thinking is that if Darwin had any idea of the complexity of the cell (which he didn't, because it was not known at that time), he would not have proposed evolution.

And you blokes (/girls?) have all fallen for the same trap. Because although I said that it was designed to be harder, I didn't explain how this was so, and you assumed something simpler than was really the case.

The point is that my phase—trap big animal paws— is a bi-directional phrase. It also reads (from right to left), swap lamina gib [jib] part. So let's see how everyone went with reading it backward (a "fail" means that the meaning has been replaced with gibberish):

  • Neveruse513:
    • swap lamina tib parw I: Fail
  • HermanH:
    • swap lamina gip part: Fail
    • swap lamina gib part I: Fail
    • swap lamina gib ym part: Fail
  • Acionyx:
    • part reab a ni swap tac part I: Fail

Sterile had a point: An English-language analogy has it's limits. In this case, I've made the English-language phrase slightly more realistic to DNA than the English language already is. Because this is exactly the sort of thing that happens with DNA. See Genetic information#Complexity which I'm adding now.

Producing information, i.e. a string of characters with meaning, is essentially not going to happen by chance. But even if it could (or to the extent that it can), producing a string that has two meanings when read in two directions (or more; see that link) is beyond belief. It took me quite a few hours to come up with that short phrase (and I still got it wrong), and that was with the help of a web-site I found that listed words that could also be read validly backwards. (By the way, one thing I noticed was that it got harder the longer the phrase. I could relatively easily have come up with a two-word phrase. I could have left "big" out and had a three-word phrase. This was about the only half-decent four-word phrase I could come up with, and I gave up any hope of having a five-word phrase.) To suggest that random mutations could design this sort of interlocking complexity is to engage in fantasy. And to suggest that a random change can improve it without damaging or destroying the other messages in the same sequence is ludicrous.

Thanks for taking part.

Philip J. Raymentdiscuss 15:26, 24 April 2009 (UTC)

beyond belief, fantasy, ludicrous. So in the end all of it is just an argument from incredulity? The old "I can't believe it, therefore it must be false". HermanH 10:32, 25 April 2009 (UTC)
Not at all. I was arguing on the basis of the evidence when I made those comments. Philip J. Raymentdiscuss 12:46, 25 April 2009 (UTC)
Natural selection is different than chance. DNA has a direction, there are two different ends to the deoxyribose sugar. A bidirectional example has extremely low relevance to biology. Sterile 16:54, 24 April 2009 (UTC)

Philip, Sterile is correct. You have to understand that DNA is actual read in one direction 5` to 3`. Yes, DNA is synthesized in a bidirectional manner but the actual transcription is done in one direction only. Here is a short course for you about transcription. You have a double strand of DNA uncoiled lying horizontally. The top sequence (coding strand) runs from left to right 5` to 3`, the bottom 3` to 5`. When mRNA is made its sequence is mostly that of the top (coding strand) going from 5` to 3` but it does take fragments from both strands on occasions.

  • 5` ACTGTCGGATTA 3` (DNA coding strand)
  • 3` TGACAGCCTAAT 3`
  • 5` ACUGUCGGAUUA 3` (mRNA sequence)

Something that is not readily known is that mRNA does have self splice activity. Meaning that the splicosome is not needed to remove the introns that are transcribed into the mRNA all of the time. Which can lead to changes in mRNA that are not in the DNA. This is one of the catalytic abilities of RNA due to the hydroxyl group that differs RNA from DNA on the ribose. So to the main point bidirectional is not a good measurement of your test since it does not apply to transcription nor is using a test of words a good indicator of why it would not work. There are many factors about transcription and translation that most people are not taught until grad school, and for those who hold medical degrees instead of a degree in biochemistry or molecular biology, well they are not exposed to this since it has no real application in their fields. This is why it is important for you to find a reference that is from a person with real training and through understanding instead of the gibberish that is pushed, I am sorry but a vetinarian is not a replacement for a geneticist.--Timsh 17:53, 24 April 2009 (UTC)

Did either of you read the material that I posted the link to? It says that you are wrong.
This is why it is important for you to find a reference that is from a person with real training and through understanding...: Which is precisely what I did?
...a vetinarian is not a replacement for a geneticist.: What are you talking about?
Philip J. Raymentdiscuss 01:58, 25 April 2009 (UTC)
This was written by a vet. You used it as a reference for the red hair argument above, while the other article was about skin tone.--Timsh 12:59, 25 April 2009 (UTC)
Are you posting in the right section? We haven't been discussing red hair in this section. Philip J. Raymentdiscuss 13:55, 25 April 2009 (UTC)
Philip, really, creating a test with rules that you do not disclose based on an analogy that is deeply flawed is just silly. Yes, I know that you did it to illustrate that you find it unbelievable that random changes can create more information, but your own incredulity is not persuasive. Please, you need to think this one through again without the language comparison - genetics just doesn't work like that. Ajkgordon 21:28, 24 April 2009 (UTC)
The "rules" were disclosed. Only the level of complexity was not disclosed. The analogy was valid. It's not incredulity, but a reasoned deduction from observation and evidence. Philip J. Raymentdiscuss 01:58, 25 April 2009 (UTC)

Do you mean the quote for which it says, "imagine a sentence," and then goes on to talk about nothing to do with genetics. In fact, it talks about the degeneration of a signal by randomizing every fourth letter, a perfect, to-the-description statement of loss of information in the Shannon sense. Is that the one? Sterile 02:20, 25 April 2009 (UTC)

I am talking about a quote which includes the phrase "imagine a sentence", but the rest of your description does not match the quote I'm talking about. Philip J. Raymentdiscuss 02:32, 25 April 2009 (UTC)
Sorry--i read too fast. How is "degeneration of the signal" not be loss of information in the Shannon sense? Sterile 02:42, 25 April 2009 (UTC)
I take your "read too fast" comment to mean that you are retracting some of your previous comment. But which part(s)? Yes, degeneration of the signal is loss of information (not necessarily in the Shannon sense, but that's a separate issue). What is actually your point? That the quote doesn't support my sentence analogy, or what? Philip J. Raymentdiscuss 03:57, 25 April 2009 (UTC)
Degradation of the signal, the introduction of "static" or "noise," is an increase in information entropy. Sterile 10:46, 25 April 2009 (UTC)
Yes. So? Philip J. Raymentdiscuss 12:46, 25 April 2009 (UTC)

Test was ridiculous, but...

You've presented a wonderful off-topic word puzzle to those of us addicted to them, PJR. See how many words one can get into a bidirectional sentence... where was that site that had the bidi word cheat sheet? PS: Able I was, ere I saw Elba, Madam, I'm Adam (the first palidrome). ħuman Number 19 00:48, 25 April 2009 (UTC)

Good Google terms to start with: Palindrome ("A man, a plan, a canal. Panama.") and Semordnilap (what Philip was going for). Note that the latter can be used to quasi-easily construct the former: "avid diva" or "repaid diaper" for example. --Sid 01:15, 25 April 2009 (UTC)
The puzzle was not off-topic; it illustrated an important point. I can't readily find the site again. I limited myself because I wanted something that did not read the same backwards and forwards. Palindromic words and sentences were out. I also limited myself to phrases that had the word breaks in the same place. DNA, with fixed-length "words", doesn't have word breaks. In theory, this opens up more possibilities (e.g. Panama = A man, a plan), but the semordnilap word list then doesn't provide all the possible words. Philip J. Raymentdiscuss 02:16, 25 April 2009 (UTC)
It was "off topic" because it has nothing to do with - [deleted by management] - I looked up to see what the article is about: "Great Flood". It was also off topic because it has nothing to do with how genetics/DNA work. It took a bad analogy so far it wasn't funny. Thanks for the tips on how to find the cheat sheet, though. ħuman Number 19 03:00, 25 April 2009 (UTC)
Okay, it was off topic for the flood, but it was on topic for the discussion that was being had here. And it is everything to do with how genetics/DNA work, as explained above and not refuted (although incorrectly denied by others above). It was a good analogy. Philip J. Raymentdiscuss 03:53, 25 April 2009 (UTC)

Complaints by test entrants

Referee! My entry (trap BIG animal paws) was disallowed because there are no capital letters in DNA? The question didn't say you could only do things that the DNA code can do! I'm not saying I have proved anything about evolution, but I am saying that I did add information without destroying any so I should get a point in recognition of that.--CPalmer 11:36, 26 April 2009 (UTC)

I would agree since concentration of protein expressed does have an impact on the organism. In this case big vs. BIG would be very significant.--Timsh 13:19, 26 April 2009 (UTC)

Over the last 100 years...

Why 100 years? Is there a citation for this? Neveruse513 15:57, 30 March 2009 (UTC)

Its a rough outline. Can you find an earlier mention? Geo.plrd 05:43, 31 March 2009 (UTC)
I'd say about 200 years, but I don't have a reference handy right at the moment. Philip J. Raymentdiscuss 05:53, 31 March 2009 (UTC)

Looking at the above...

What do obscure word games have to do with evolution or genetics? I mean, I know Andrew Layton Schlafly probably believes that his god speaks English--but language has noting to do with genetics; linguistic "information" is not the same thing as genetic "information"--one is a human construct, one a series of chemical phenomena. Can some please explain to me in small words what PJR's vocabulary games do to prove anything beyond the realm of the English language? TheoryOfPractice 01:21, 25 April 2009 (UTC)

a more interesting analogy

OK, in DNA we have four "letters". So let's make it simple: ABCD.

Interesting case: "abacab". Abacab is not a "meaningful" English word. However, it still has three meanings. First, it is the title of Genesis album (well, third, really). Second, it is a rhyme scheme - a meaning only to prosodists. Third, it is a melody - a series of notes in the keys of C or G (at least).

Using the third meaning, let us mutate it, using our four letters. Any change using our four letters is still a melody. Some may be more readily enjoyable, others more difficult, but: they are all still melodies - and playable. Insertion, inversion, and mutation of this "melody" are what is presented in the canon of classical music. Even, in the end, the most dissonant melodies and harmonies, have meaning. CCCA.... (might be wrong, but you get my drift I hope) ħuman Number 19 03:58, 25 April 2009 (UTC)

Melodies are not information. They don't carry (semantic, etc.) meaning. Philip J. Raymentdiscuss 12:56, 25 April 2009 (UTC)
DNA doesnt have semantic meaning either Hamster 16:21, 25 April 2009 (UTC)
On the contrary, it does. Philip J. Raymentdiscuss 23:57, 25 April 2009 (UTC)
You're twisting the meaning of "semantic" from a highly refined term of art to the colloquial sense - again. And if you think melodies aren't information, what on earth are they? Can you hum CCCA? Does it mean something to you? ħuman Number 19 00:04, 26 April 2009 (UTC)
I'm not twisting it. I'm quoting information specialists. Philip J. Raymentdiscuss 03:52, 26 April 2009 (UTC)
Without knowing what they are saying. Do you know what "term of art" means? Does your "source" define "semantic" (I bet he does) earlier in his paper? ħuman Number 19 07:44, 26 April 2009 (UTC)
What makes you think that I'm quoting without knowing what they are saying? That's rather presumptuous of you, isn't it? Philip J. Raymentdiscuss 08:39, 26 April 2009 (UTC)
Not really - you quote 2 1/2 sentences written by a philosopher without also quoting where he defines the terms he is using. I'd like to see what he calls "defined semantics". Now, here: "When in the rest of this chapter we refer to "biological" information, it will be precisely this semantic aspect of information that is meant." means that he is only talking about that particular aspect. "A theory of the origin of life must therefore necessarily include a theory of the origin of semantic information." According to this one guy's book. I'd also like to see the definition he uses for "semantic". Actually, I guess I'd like to see a copy of the book, I wonder if it's worth a trip to the local uni. library? Also, from the precis at google books, it appears he is only discussing the origin of life (abiogenesis and its ramifications), not its subsequent evolution. ħuman Number 19 19:09, 26 April 2009 (UTC)
PS, can I quote Kuppers in articles, too? ħuman Number 19 23:32, 26 April 2009 (UTC)
I'd also like to see the definition he uses for "semantic".: How about...

Information, the central concept of this book, is simply a modern, quantified, version of what the Greeks called eidos, or "form"; it is a measure of the amount of structure. The three "dimensions" of information, presented in the second chapter, make this matter clear. Syntactic information is a counting of the formal medium without regard to its meaning. Semantic information concerns the meaning, that is, what we understand when we understand a structure, within the framework of the dualism of subject and object as invented by modern philosophy...[p.xv]

The term "biological information" requires clarification, and that is the purpose of part II. It will be shown that three dimensions of information can be distinguished: its syntactic, semantic, and pragmatic aspects. The syntactic aspect of information, subject of the information theory of Claude Shannon, is only of subordinate importance for a precise definition of the concept of "biological information" (chapter 3). In contrast to this, the semantic aspect is essential, since the elements of an organism that are governed by information have a special purpose and a meaning in the context of the maintenance of its life functions (chapter 4).[p.xviii]

Philip J. Raymentdiscuss 12:34, 27 April 2009 (UTC)
Regarding quoting Kuppers, we've not really laid down any restrictions on who can be quoted and who can't be quoted. However, quoting an opinion of someone when that opinion is based on a non-biblical worldview and is contrary to a biblical worldview is not normally going to carry much weight. So saying "Geneticist Dr. X says that there's 3043 genes in chromosome P" is okay, because that is (presumably) factual. And saying that "Geologist Dr. Y believes that strata N was laid during the recessive stage of the flood" is okay, because his presuppositions are consistent with the worldview of this site. But saying that "Palaeontologist Dr. Z believes that dinosaurs evolved into birds" is not okay, because it is not a fact and his presuppositions are at odds with the worldview of this site. Philip J. Raymentdiscuss 09:45, 1 May 2009 (UTC)
I wrote an excellent article wholly in keeping with the world view of this site. I used the Bible as the only reliable source of information. It was deleted as parody. What exactly is the worldview of this site? Cluitie 13:39, 2 May 2009 (UTC)
It was deleted as parody because it read as parody, with claims based on a superficial reading or even misreading of the Bible, and a tone that made it appear as though belief in the Bible is old fashioned and unreasonable. Philip J. Raymentdiscuss 14:27, 2 May 2009 (UTC)
The article simply described what the Bible tells us about Homo sapiens. The Bible was neither read or misread but simply quoted. Is the Bible parody. Do you find some things in the Bible embarrasing and prefer not to have them mentioned? --Unsigned comment by Cluitie (talk)
No, the article was not "simply quoted", it was summarised and/or explained, which is legitimate, but in this case the summaries/explanations were not accurate. For example, it said that "It is God's will that men should rule over women", yet the reference does not say that. Rather, it was talking specifically to Eve with respect to her husband. It is quite reasonable to say that this was to apply to her descendants also, but was it men ruling over women or husbands over wifes (two quite different things), for example? Then of course something can be misrepresented by selective quoting, so although all quoting is by nature selective, claiming that it's fair representation simply by appeal to it being quotes is insufficient. Philip J. Raymentdiscuss 03:15, 3 May 2009 (UTC)
You have a fair point about God's will that men should rule over women. The Bible quotes clearly mention that fathers and husbands and not that men in general rule over women. One must be careful when making assumptions from what the Bible tells us and what God expects of us. Cluitie 15:10, 5 May 2009 (UTC)

Germs

For numerous communicable diseases, such as measles, pneumococcal pneumonia, leprosy, typhus, typhoid fever, small pox, poliomyelitis, syphilis and gonorrhea, the only known host is man. That is, the germs or viruses which cause these diseases can survive only in living human bodies or human cell culture. Somebody must have carried them onto Noah's Ark. Now here is where this is a problem and I would like our creationist friends to address the following issue, once a person has the virus and survives the disease they are immune to the disease. As such how did these germs survive the trip on the Ark? Consider the following

  1. Measles average incubation period 14 days (range 6-19 days) Infectivity is 2-4 prior and 2-5 days following incubation. As such the life cycle of the virus is 28 days on the high end. Meaning that Noah's family would have to pass the disease among each other several times to allow for it to continue to today in the population, which begs the question was the immune system of Noah and his family worse than our immune systems since the only way the virus would survive the ark was to reinfect the passengers multiple times?
  2. How did Noah's family reproduce considering that many of these communicable diseases cause sterility in humans as well as birth defects?
  3. Consider this as well, humans are not the only animals that have communicable diseases so the situation applies to the other animals on the ark. As such how did Noah's family deal with being sick and the animals being sick?

--Timsh 17:28, 12 November 2009 (UTC)

Zoonosis is a potential explanation. Also, new diseases could have arisen through mutation. Failing that, divine action. SallyM 17:43, 12 November 2009 (UTC)
Zoonosis does not apply, thus the reason for the "can survive only in" statement. Whereas there are plenty of viruses and bacteria that can bounce between species I am addressing only the ones that are specific to the species. As for mutations, in the case of these germs, we would have to classify these mutations as increasing information since they became more specific in their communicability, else they would spread to other animals currently. As others have stated regarding information, mutations only decrease information therefore become less specific.--Timsh 18:38, 12 November 2009 (UTC)
Sorry about the zoonosis confusion, but isn't it possible that the diseases "can now only survive in" humans? I'm not sure what the jazz about information is about. And it seems that some people here avoid divine action like, well...leprosy :) I'm not entirely sure why. SallyM 18:51, 12 November 2009 (UTC)

This "problem" has been raised before, but I forget by who and where, so...

The answer that I think is most likely is post-flood mutations, but not, as you assumed, mutations from animal diseases, but mutations from beneficial bacteria and viruses to harmful ones.

There's two issues here: how did these things arise, and when did they arise. Because God made the world "very good", He did not create it with problems such as disease. Therefore these things have come about later, as a result of the Fall (which doesn't mean that they happened at the Fall.) The best explanation for them arising is by things breaking down, i.e. genetic mutations. So that's the how. As for the when, the flood was about 1500 years after creation, and we are about 4500 years after the flood. So obviously most of the time available for this to happen is post-flood. Therefore, although some germs and (harmful) viruses could have predated the flood, most would be post-flood, and any that could not have survived the flood (including because their hosts couldn't survive the flood) would not have been on the ark, and therefore all those germs and viruses must have come about since the flood.

That doesn't rule out other possibilities, such as some germs and viruses being more virulent now (and their predecessors were able to survive the Flood), or of being able to survive off the ark somehow.

Philip J. Raymentdiscuss 01:43, 13 November 2009 (UTC)

Philip, I am working under the assumption that these organisms occurred after the fall but before the Ark. I believe for the occurrence of the germs to progress to the degree of pathogenesis would require quite a number of mutations that would be considered gaining information, as the mutations would cause more specificity to the host as well as acquiring pathogenic forms of transmission. I believe there may be a problem stating that the germs were not around pre-flood since there are conflicting reports of Smallpox outbreaks in India and China at 3000 BC. In fact the first known method of vaccination occurred with the Chinese around that time by their inhalation of the dried small pox scabs. So even with the conflict of the flood timeline, it is known that the small pox virus was pathogenic near the flood event. As such the virus would have to undergo a rapid mutation path not seen during the decades it has been studied. In other words, for your hypothesis to be correct there had to be some event to slow the mutation rate of the virus to what we see today. Interestingly enough for this to happen the virus would have to mutate regulatory proteins to regulate its mutation rate which is against your definition of a mutation causing things to break down. So either the germs were present on the ark in the forms we see today or similar pathogenic forms or the hypothesis of mutations only causing break downs is false. Which case is it? Either explain how the organisms on the ark survived the germs or explain how the germs became pathogenic without the creation of new information allowing for both parthenogenesis and reduction of mutation rates by regulatory function creation without violating the breaking down caused by mutations.--Timsh 21:36, 13 November 2009 (UTC)
...I am working under the assumption that these organisms occurred after the fall but before the Ark. Why?
I believe there may be a problem stating that the germs were not around pre-flood since there are conflicting reports of Smallpox outbreaks in India and China at 3000 BC. That would presumably be on the secular timescale, not the biblical one, as on the biblical one there was no China nor India in 3000 BC.
The rest of your argument relies on assumptions on mutations rates and what mutations can achieve, and as such, I don't believe that you've made a case that I need to answer.
Philip J. Raymentdiscuss 10:25, 14 November 2009 (UTC)

two or seven

Concerning Philip's revision of my edit: I wondered how long it would take for me to get in your hair. But that's not what I'm here for. I'll let you choose this one. Consider my question here not harassment, but an effort to understand the rules of the game so we can work together with less friction.

The passage in question is in the lead, where the subject should be presented from the Biblical worldview, that is, "one that treats the Bible as factually correct in all of its propositions". Concerning the number of each kind of animal taken onto the ark, as far as I know, only two passages are relevant, the ones I cited:

Genesis 6:19–20 (NIV): You are to bring into the ark two of all living creatures, male and female, to keep them alive with you. Two of every kind of bird, of every kind of animal and of every kind of creature that moves along the ground will come to you to be kept alive.

and

Genesis 7:2–3 (NIV): Take with you seven of every kind of clean animal, a male and its mate, and two of every kind of unclean animal, a male and its mate, and also seven of every kind of bird, male and female, to keep their various kinds alive throughout the earth. (In your edit summary you wrote "Only land-dwelling and air-breathing." Did you mean flying creatures where you said air-breathing creatures?)

The straightforward reading of the first passage is that Noah was required to take (and presumably did take) two specimens of each kind of animal, one male and one female. "... two of all living creatures ..." The straightforward reading of the second passage is that he took seven of each kind of clean (land) animal and bird (although it is somewhat mysterious what is meant by "seven ... male and female"), and two of each kind of unclean (land) animal.

If I start from the assumption that the Bible is without error, then I have to conclude I am too dumb to figure out if there where seven doves on board or only two. The only safe course of action, it seems to me, is to cite both passages and leave the question open. Why do you give priority to the second passage?

--Awc 15:27, 8 September 2010 (UTC)

I always thought that with this one, God gave a general instruction first and then a more detailed one later on. Like if you said "I want bookshelves along these three walls", and then later "OK, so put bookshelves along these two walls and CD racks along this one".--CPalmer 16:04, 8 September 2010 (UTC)
So if the Bible is accurate but not complete - and I think we can agree on the second point - then God might later have further refined His instructions by telling Noah to take not 7 but four-and-twenty blackbirds. One consequence of your way of looking at things, and possibly of any way of looking at these passages, is that we can never be sure of what the Bible is saying. Whenever we read something like "two of all living creatures", we have to keep in mind that this could mean two of most creatures but more of some (7 birds) and none at all of others (0 fish). What do the standard commentators say on this point? It's not like I'm the first one to ever notice it. --Awc 16:49, 8 September 2010 (UTC)
the lists of clean and unclean are in Leviticus 11:3 and Deuteronomy 14:6. He had to take 7 of the clean animals because God demanded sacrifices after the Ark landed and killing your breeders would have been bad. Hamster 17:51, 8 September 2010 (UTC)
That is an interesting point, Awc. To an extent, I suppose you have to trust the chronicler of the flood story to include the important details in his own story. Maybe they spent the forty days of the flood battling sea monsters with sticks - who knows?
More generally, re being sure what any part of the Bible is saying, I would tend to agree with St Paul - you need to use your own judgement (supported by faith and prayer) to fill in the gaps. He touches on this point in many, maybe most, of his letters. I agree with you that it is difficult to be certain, but I would argue that certainty is not necessarily the best goal to aim for - Jesus spent a lot of his time arguing against people who thought they had it all worked out.--CPalmer 08:28, 9 September 2010 (UTC)
Would Jesus have argued with Philip? not a member! 09:34, 9 September 2010 (UTC)
He argued with everybody! (So stop trying to make trouble.)--CPalmer 09:41, 9 September 2010 (UTC)
In that case why did you find it noteworthy that he argued "against people who thought they had it all worked out"? And me, trying to make trouble? Never. not a member! 10:20, 9 September 2010 (UTC)
Well, because all his most famous arguments were with the Pharisees, and they certainly would have fallen into that category. But there are several instances of him chiding his disciples also.--CPalmer 11:20, 9 September 2010 (UTC)
Pharisees and Philip. I'd say there's more in common than the first two characters of the name. not a member! 14:02, 9 September 2010 (UTC)
Sadly I think many people are prone to Pharisee-like behaviour at times, myself included. Hence the enduring relevance of Jesus' teachings.--CPalmer 14:50, 9 September 2010 (UTC)

(OD) I largely agree with CPalmer and Hamster (I'm shocked, too) on this. The first passage is more about the general principle of preserving breeding pairs, and the second passage goes into more detail. I recall something about the "two of" actually being "two by two" or "two two" or something like that, meaning "pairs of" or even "two pairs". Likewise the seven was "seven seven" meaning "seven pairs". I need to refresh my memory on that.

Interestingly just reading it now in whatever version Awc chose, the first passage says how many animals are to be taken aboard to be kept alive whereas the second passage says how many animals to take (i.e. in total, including sacrifices etc). So in addition to the previous comments about general and specific, the text itself shows that the "sevens" to be taken constitute a super-set of the "twos" to be kept alive. LowKey 11:55, 9 September 2010 (UTC)

Ingenious, but: "Take with you ... seven of every kind of bird, male and female, to keep their various kinds alive throughout the earth." Also, the "seven of every kind of clean animal/bird, a male and its mate/female" only seems to make sense if it means seven pairs (as is mentioned in a footnote on bible.logos.com). But then it would seem we should read the two as being two pairs, so having four of some kinds of animals on the ark seems to be a logical reading. All in all, God's instructions as reproduced in the Bible are hopelessly muddled. All we can say is, Noah was supposed to take each kind of animal with him, and of each kind at least one male and one female. (duh!) That's the only important part anyway. So, unless we want to get into detailed commentary, I propose striking the sentence mentioning the number of specimens (although it would be more fun to point out the confusion). --Awc 13:33, 9 September 2010 (UTC)
Give a reference to the relevant verses so that people can read for themselves how many it was.--CPalmer 13:49, 9 September 2010 (UTC)
I did that. Then Philip changed it. --Awc 14:00, 9 September 2010 (UTC)

(OD)Awc, the instructions are not muddled.

  • Remember that this is an account that includes God's instructions, not a comprehensive documentation of all the detailed instructions for building, stocking and managing an ark.
  • Repetition with increased detail is common to journalism. Also, even modern instructions often feature repetition with additional detail. That this is also a feature of an ancient Hebrew chronicle is not a problem.
  • The first statement says to take pairs to be kept alive - the passage mentions this twice. These pairs of individuals are to be kept alive. I checked the Hebrew and it wasn't "two two" as I thought but just "two" meaning either simply "two" or specifically a [matched] pair. This passage doesn't seem to specifically rule out multiple pairs, but (to me at least) seems to imply single pairs.
  • The second passage says to take additional individuals of the clean kinds. The phrase used is "seven seven" which would usually mean seven sets (pairs in this case) but can sometimes mean a complete set. The clean kinds would be suitable for food and sacrifices; in other words, clean animals were available to be killed. The reason given in the passage is "to keep seed alive"; in other words to ensure that the goal in the first passage is not negated. This passage again mentions a pair of each unclean kind, "to keep seed alive." This passage shows that additional "consumable" animals were required in order to ensure that breeding pairs are kept alive. This passage does seem to rule out multiple pairs of unclean kinds.
  • As you said, the important point is that at least a breeding pair from each kind was preserved. The rest is detail about how that was achieved. LowKey 01:16, 10 September 2010 (UTC)
At http://bible.cc/genesis/7-2.htm you can see several translations and commentaries in parallel. The "seven seven" bit is mentioned several times. Unfortunately, this is not a modern idiom, so even if the instructions in the Bible were not confusing when they were first written, they certainly are now. Your interpretation is plausible but not necessary. Several commentators conclude that of the clean animals there were 3 males and 3 females for rapid reproduction, and one odd male for sacrifice. If God had wanted the Bible to be a precise document, where every single word is to be taken literally, He would have written, "You are to bring into the ark at least two of all living creatures, ..." (Or was he trying to save space?) --Awc 07:35, 10 September 2010 (UTC)
I don't think you can criticise God for the failure of modern Englishmen to understand ancient Hebrew idioms.--CPalmer 08:03, 10 September 2010 (UTC)
Like I said, either seven sets or a complete set, as in sufficient to allow sacrifice and/or consumption while ensuring the survival of a breeding pair. I don't really have a problem with the "3 pairs plus one" interpretation except for it being a little less likely linguistically than seven pairs.
If God had wanted the Bible to be a precise document, where every single word is to be taken literally, He would have written... Well, then, I am glad that I don't confuse accuracy for precision or take every word literally. :) Also, remember that the Bible (or in this case Genesis specifically) was not given to Noah so that he could build and stock the ark. It is a record of the building and stocking (etcetera).
"You are to bring into the ark at least two of all living creatures, ..." (Or was he trying to save space?) Actually, what you propose takes less space than the existing text, and conveys less. I expect that those criticising the text would be just as dissatisfied with your proposed text - how many is "at least two"? were the numbers the same for all kinds, or did they vary?
Note my final point above, agreeing with your earlier point. LowKey 12:52, 10 September 2010 (UTC)
I'm just catching up with this conversation, but I note that CPalmer and LowKey have covered pretty well everything that I would have (and more), so there's not much to add.
In an edit comment, Bradley (LowKey) wrote "NIV is at odds with most reliable translations; which say "seven pairs" (KJV says "by sevens")". Not only does the NIV include the alternative reading of "seven pairs" in a footnote, as CPalmer pointed out, but the TNIV, an update to the NIV, also says "seven pairs" (Genesis 7:2-3, TNIV)
Give a reference to the relevant verses so that people can read for themselves how many it was. followed by I did that. Then Philip changed it. I've no problem with giving both, as long as it's not to give the impression that they are contradictory, as bibliosceptics love to claim. The way it was worded could have been read that way.
(In your edit summary you wrote "Only land-dwelling and air-breathing." Did you mean flying creatures where you said air-breathing creatures?) No, I meant air-breathing. First, I would include flying creatures in "land-dwelling", which is meant to distinguish from water-dwelling. Second, Genesis 7:15 and Genesis 7:22 refer to creatures that had "the breath of life".
Philip J. Rayment 13:11, 15 September 2010 (UTC)

(OD)Regarding my change to "seven pairs" and the edit comment; the existing content said "seven" & the reference was simply the NIV translation. "Seven pairs" was not a footnote here, & RefTagger did not include the NIV footnote in the pop-up. It seemed to me that since "seven pairs" is the primary translation, the article and the RefTagged verse should show that. (I wasn't trying to say that NIV disagrees with "seven pairs" just that its presentation was different).

On a re-read of previous posts I realised that I read Awc's Or was he trying to save space? to mean saving space in the instructions when the intent was probably saving space on the ark. I think the reason for the specific instructions was for the most efficient use of all resources (time, space, labour, stock) so the short answer is a qualified "yes." LowKey

Personal tools
visitor navigation